ID: 939957077

View in Genome Browser
Species Human (GRCh38)
Location 2:148536076-148536098
Sequence CTAGATATTGAGAGCAGACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939957077_939957082 27 Left 939957077 2:148536076-148536098 CCTGGTCTGCTCTCAATATCTAG No data
Right 939957082 2:148536126-148536148 CCACCTGGTACCAATGAAATGGG No data
939957077_939957080 26 Left 939957077 2:148536076-148536098 CCTGGTCTGCTCTCAATATCTAG No data
Right 939957080 2:148536125-148536147 CCCACCTGGTACCAATGAAATGG No data
939957077_939957078 12 Left 939957077 2:148536076-148536098 CCTGGTCTGCTCTCAATATCTAG No data
Right 939957078 2:148536111-148536133 GTTCAAAAATGAAACCCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939957077 Original CRISPR CTAGATATTGAGAGCAGACC AGG (reversed) Intergenic
No off target data available for this crispr