ID: 939958287

View in Genome Browser
Species Human (GRCh38)
Location 2:148545127-148545149
Sequence CTTTTGAGTTAGGGAGTTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939958278_939958287 21 Left 939958278 2:148545083-148545105 CCTGTCCATCTGTCTTGGTGCCT No data
Right 939958287 2:148545127-148545149 CTTTTGAGTTAGGGAGTTGTGGG No data
939958276_939958287 23 Left 939958276 2:148545081-148545103 CCCCTGTCCATCTGTCTTGGTGC No data
Right 939958287 2:148545127-148545149 CTTTTGAGTTAGGGAGTTGTGGG No data
939958283_939958287 -9 Left 939958283 2:148545113-148545135 CCATGAGAGTCACTCTTTTGAGT No data
Right 939958287 2:148545127-148545149 CTTTTGAGTTAGGGAGTTGTGGG No data
939958282_939958287 -8 Left 939958282 2:148545112-148545134 CCCATGAGAGTCACTCTTTTGAG No data
Right 939958287 2:148545127-148545149 CTTTTGAGTTAGGGAGTTGTGGG No data
939958281_939958287 -7 Left 939958281 2:148545111-148545133 CCCCATGAGAGTCACTCTTTTGA No data
Right 939958287 2:148545127-148545149 CTTTTGAGTTAGGGAGTTGTGGG No data
939958277_939958287 22 Left 939958277 2:148545082-148545104 CCCTGTCCATCTGTCTTGGTGCC No data
Right 939958287 2:148545127-148545149 CTTTTGAGTTAGGGAGTTGTGGG No data
939958279_939958287 16 Left 939958279 2:148545088-148545110 CCATCTGTCTTGGTGCCTGAAAT No data
Right 939958287 2:148545127-148545149 CTTTTGAGTTAGGGAGTTGTGGG No data
939958280_939958287 1 Left 939958280 2:148545103-148545125 CCTGAAATCCCCATGAGAGTCAC No data
Right 939958287 2:148545127-148545149 CTTTTGAGTTAGGGAGTTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939958287 Original CRISPR CTTTTGAGTTAGGGAGTTGT GGG Intergenic
No off target data available for this crispr