ID: 939960468

View in Genome Browser
Species Human (GRCh38)
Location 2:148561212-148561234
Sequence TCCCTAAGGCTGCCCCAGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939960458_939960468 15 Left 939960458 2:148561174-148561196 CCTGCAGAACCCCTCTACAGCTG No data
Right 939960468 2:148561212-148561234 TCCCTAAGGCTGCCCCAGGCCGG No data
939960457_939960468 21 Left 939960457 2:148561168-148561190 CCTCTTCCTGCAGAACCCCTCTA No data
Right 939960468 2:148561212-148561234 TCCCTAAGGCTGCCCCAGGCCGG No data
939960462_939960468 -8 Left 939960462 2:148561197-148561219 CCTCCAATTCCTTCCTCCCTAAG No data
Right 939960468 2:148561212-148561234 TCCCTAAGGCTGCCCCAGGCCGG No data
939960456_939960468 22 Left 939960456 2:148561167-148561189 CCCTCTTCCTGCAGAACCCCTCT No data
Right 939960468 2:148561212-148561234 TCCCTAAGGCTGCCCCAGGCCGG No data
939960459_939960468 6 Left 939960459 2:148561183-148561205 CCCCTCTACAGCTGCCTCCAATT No data
Right 939960468 2:148561212-148561234 TCCCTAAGGCTGCCCCAGGCCGG No data
939960461_939960468 4 Left 939960461 2:148561185-148561207 CCTCTACAGCTGCCTCCAATTCC No data
Right 939960468 2:148561212-148561234 TCCCTAAGGCTGCCCCAGGCCGG No data
939960460_939960468 5 Left 939960460 2:148561184-148561206 CCCTCTACAGCTGCCTCCAATTC No data
Right 939960468 2:148561212-148561234 TCCCTAAGGCTGCCCCAGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939960468 Original CRISPR TCCCTAAGGCTGCCCCAGGC CGG Intergenic
No off target data available for this crispr