ID: 939964115

View in Genome Browser
Species Human (GRCh38)
Location 2:148593745-148593767
Sequence GAGCCTTGGCTCTAGATCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939964112_939964115 28 Left 939964112 2:148593694-148593716 CCATACAGACAATAGGCAGTGAG No data
Right 939964115 2:148593745-148593767 GAGCCTTGGCTCTAGATCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939964115 Original CRISPR GAGCCTTGGCTCTAGATCAG TGG Intergenic
No off target data available for this crispr