ID: 939970248

View in Genome Browser
Species Human (GRCh38)
Location 2:148650270-148650292
Sequence ATATAGATAGATATTGGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939970248_939970253 18 Left 939970248 2:148650270-148650292 CCTCCCCCAATATCTATCTATAT No data
Right 939970253 2:148650311-148650333 ATTTGATAAAGTCTTCTTCCAGG No data
939970248_939970254 30 Left 939970248 2:148650270-148650292 CCTCCCCCAATATCTATCTATAT No data
Right 939970254 2:148650323-148650345 CTTCTTCCAGGAATTCTTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939970248 Original CRISPR ATATAGATAGATATTGGGGG AGG (reversed) Intronic
No off target data available for this crispr