ID: 939970248 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:148650270-148650292 |
| Sequence | ATATAGATAGATATTGGGGG AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 939970248_939970253 | 18 | Left | 939970248 | 2:148650270-148650292 | CCTCCCCCAATATCTATCTATAT | No data | ||
| Right | 939970253 | 2:148650311-148650333 | ATTTGATAAAGTCTTCTTCCAGG | No data | ||||
| 939970248_939970254 | 30 | Left | 939970248 | 2:148650270-148650292 | CCTCCCCCAATATCTATCTATAT | No data | ||
| Right | 939970254 | 2:148650323-148650345 | CTTCTTCCAGGAATTCTTTTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 939970248 | Original CRISPR | ATATAGATAGATATTGGGGG AGG (reversed) | Intronic | ||
| No off target data available for this crispr | |||||