ID: 939977837

View in Genome Browser
Species Human (GRCh38)
Location 2:148739626-148739648
Sequence TTCTGTGTAGGTAAGGAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939977837_939977842 25 Left 939977837 2:148739626-148739648 CCCACTTCCTTACCTACACAGAA No data
Right 939977842 2:148739674-148739696 AACCAAATTTTCCTGAGCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939977837 Original CRISPR TTCTGTGTAGGTAAGGAAGT GGG (reversed) Intronic
No off target data available for this crispr