ID: 939979808

View in Genome Browser
Species Human (GRCh38)
Location 2:148766578-148766600
Sequence CTGGAAAATTACTCTTTTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939979808_939979813 -3 Left 939979808 2:148766578-148766600 CCTACAAAAGAGTAATTTTCCAG No data
Right 939979813 2:148766598-148766620 CAGATAGAAAGTATAGGGAAGGG No data
939979808_939979816 21 Left 939979808 2:148766578-148766600 CCTACAAAAGAGTAATTTTCCAG No data
Right 939979816 2:148766622-148766644 TCTAGGCACAGCATATTAGAGGG No data
939979808_939979812 -4 Left 939979808 2:148766578-148766600 CCTACAAAAGAGTAATTTTCCAG No data
Right 939979812 2:148766597-148766619 CCAGATAGAAAGTATAGGGAAGG No data
939979808_939979815 20 Left 939979808 2:148766578-148766600 CCTACAAAAGAGTAATTTTCCAG No data
Right 939979815 2:148766621-148766643 TTCTAGGCACAGCATATTAGAGG No data
939979808_939979814 4 Left 939979808 2:148766578-148766600 CCTACAAAAGAGTAATTTTCCAG No data
Right 939979814 2:148766605-148766627 AAAGTATAGGGAAGGGTTCTAGG No data
939979808_939979810 -8 Left 939979808 2:148766578-148766600 CCTACAAAAGAGTAATTTTCCAG No data
Right 939979810 2:148766593-148766615 TTTTCCAGATAGAAAGTATAGGG No data
939979808_939979809 -9 Left 939979808 2:148766578-148766600 CCTACAAAAGAGTAATTTTCCAG No data
Right 939979809 2:148766592-148766614 ATTTTCCAGATAGAAAGTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939979808 Original CRISPR CTGGAAAATTACTCTTTTGT AGG (reversed) Intronic
No off target data available for this crispr