ID: 939979810

View in Genome Browser
Species Human (GRCh38)
Location 2:148766593-148766615
Sequence TTTTCCAGATAGAAAGTATA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939979806_939979810 21 Left 939979806 2:148766549-148766571 CCATTTTGAAGGAATGAGGGATA No data
Right 939979810 2:148766593-148766615 TTTTCCAGATAGAAAGTATAGGG No data
939979808_939979810 -8 Left 939979808 2:148766578-148766600 CCTACAAAAGAGTAATTTTCCAG No data
Right 939979810 2:148766593-148766615 TTTTCCAGATAGAAAGTATAGGG No data
939979807_939979810 -7 Left 939979807 2:148766577-148766599 CCCTACAAAAGAGTAATTTTCCA No data
Right 939979810 2:148766593-148766615 TTTTCCAGATAGAAAGTATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939979810 Original CRISPR TTTTCCAGATAGAAAGTATA GGG Intronic
No off target data available for this crispr