ID: 939979816

View in Genome Browser
Species Human (GRCh38)
Location 2:148766622-148766644
Sequence TCTAGGCACAGCATATTAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939979811_939979816 2 Left 939979811 2:148766597-148766619 CCAGATAGAAAGTATAGGGAAGG No data
Right 939979816 2:148766622-148766644 TCTAGGCACAGCATATTAGAGGG No data
939979808_939979816 21 Left 939979808 2:148766578-148766600 CCTACAAAAGAGTAATTTTCCAG No data
Right 939979816 2:148766622-148766644 TCTAGGCACAGCATATTAGAGGG No data
939979807_939979816 22 Left 939979807 2:148766577-148766599 CCCTACAAAAGAGTAATTTTCCA No data
Right 939979816 2:148766622-148766644 TCTAGGCACAGCATATTAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939979816 Original CRISPR TCTAGGCACAGCATATTAGA GGG Intronic
No off target data available for this crispr