ID: 939985913

View in Genome Browser
Species Human (GRCh38)
Location 2:148829821-148829843
Sequence CTCCACCAGCAGGGGCTCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939985905_939985913 21 Left 939985905 2:148829777-148829799 CCTGGCTTCCTCCTGGAGATTCC No data
Right 939985913 2:148829821-148829843 CTCCACCAGCAGGGGCTCTCAGG No data
939985907_939985913 10 Left 939985907 2:148829788-148829810 CCTGGAGATTCCTCTCTGTGCTG No data
Right 939985913 2:148829821-148829843 CTCCACCAGCAGGGGCTCTCAGG No data
939985904_939985913 26 Left 939985904 2:148829772-148829794 CCTATCCTGGCTTCCTCCTGGAG No data
Right 939985913 2:148829821-148829843 CTCCACCAGCAGGGGCTCTCAGG No data
939985906_939985913 13 Left 939985906 2:148829785-148829807 CCTCCTGGAGATTCCTCTCTGTG No data
Right 939985913 2:148829821-148829843 CTCCACCAGCAGGGGCTCTCAGG No data
939985908_939985913 0 Left 939985908 2:148829798-148829820 CCTCTCTGTGCTGTCCAGCACAT No data
Right 939985913 2:148829821-148829843 CTCCACCAGCAGGGGCTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939985913 Original CRISPR CTCCACCAGCAGGGGCTCTC AGG Intergenic
No off target data available for this crispr