ID: 939988969

View in Genome Browser
Species Human (GRCh38)
Location 2:148859465-148859487
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939988969_939988972 5 Left 939988969 2:148859465-148859487 CCATGGATTGGTGAGAATAAAAA No data
Right 939988972 2:148859493-148859515 TGTTTCAGGACACTGAATTTTGG No data
939988969_939988971 -9 Left 939988969 2:148859465-148859487 CCATGGATTGGTGAGAATAAAAA No data
Right 939988971 2:148859479-148859501 GAATAAAAAATGGTTGTTTCAGG No data
939988969_939988973 10 Left 939988969 2:148859465-148859487 CCATGGATTGGTGAGAATAAAAA No data
Right 939988973 2:148859498-148859520 CAGGACACTGAATTTTGGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939988969 Original CRISPR TTTTTATTCTCACCAATCCA TGG (reversed) Intergenic
No off target data available for this crispr