ID: 939992467

View in Genome Browser
Species Human (GRCh38)
Location 2:148888351-148888373
Sequence TAGAAGGCGCTGGTGCTAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939992467_939992472 0 Left 939992467 2:148888351-148888373 CCCTTTAGCACCAGCGCCTTCTA No data
Right 939992472 2:148888374-148888396 ATGAGGTCCCTCTGCCCCGCAGG No data
939992467_939992482 29 Left 939992467 2:148888351-148888373 CCCTTTAGCACCAGCGCCTTCTA No data
Right 939992482 2:148888403-148888425 GCGCCCATTAGGGGGCCCTGTGG No data
939992467_939992480 20 Left 939992467 2:148888351-148888373 CCCTTTAGCACCAGCGCCTTCTA No data
Right 939992480 2:148888394-148888416 AGGACAAAAGCGCCCATTAGGGG No data
939992467_939992479 19 Left 939992467 2:148888351-148888373 CCCTTTAGCACCAGCGCCTTCTA No data
Right 939992479 2:148888393-148888415 CAGGACAAAAGCGCCCATTAGGG No data
939992467_939992478 18 Left 939992467 2:148888351-148888373 CCCTTTAGCACCAGCGCCTTCTA No data
Right 939992478 2:148888392-148888414 GCAGGACAAAAGCGCCCATTAGG No data
939992467_939992481 21 Left 939992467 2:148888351-148888373 CCCTTTAGCACCAGCGCCTTCTA No data
Right 939992481 2:148888395-148888417 GGACAAAAGCGCCCATTAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939992467 Original CRISPR TAGAAGGCGCTGGTGCTAAA GGG (reversed) Intronic
No off target data available for this crispr