ID: 939992468

View in Genome Browser
Species Human (GRCh38)
Location 2:148888352-148888374
Sequence TTAGAAGGCGCTGGTGCTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939992468_939992472 -1 Left 939992468 2:148888352-148888374 CCTTTAGCACCAGCGCCTTCTAA No data
Right 939992472 2:148888374-148888396 ATGAGGTCCCTCTGCCCCGCAGG No data
939992468_939992478 17 Left 939992468 2:148888352-148888374 CCTTTAGCACCAGCGCCTTCTAA No data
Right 939992478 2:148888392-148888414 GCAGGACAAAAGCGCCCATTAGG No data
939992468_939992480 19 Left 939992468 2:148888352-148888374 CCTTTAGCACCAGCGCCTTCTAA No data
Right 939992480 2:148888394-148888416 AGGACAAAAGCGCCCATTAGGGG No data
939992468_939992482 28 Left 939992468 2:148888352-148888374 CCTTTAGCACCAGCGCCTTCTAA No data
Right 939992482 2:148888403-148888425 GCGCCCATTAGGGGGCCCTGTGG No data
939992468_939992481 20 Left 939992468 2:148888352-148888374 CCTTTAGCACCAGCGCCTTCTAA No data
Right 939992481 2:148888395-148888417 GGACAAAAGCGCCCATTAGGGGG No data
939992468_939992479 18 Left 939992468 2:148888352-148888374 CCTTTAGCACCAGCGCCTTCTAA No data
Right 939992479 2:148888393-148888415 CAGGACAAAAGCGCCCATTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939992468 Original CRISPR TTAGAAGGCGCTGGTGCTAA AGG (reversed) Intronic
No off target data available for this crispr