ID: 939992470

View in Genome Browser
Species Human (GRCh38)
Location 2:148888361-148888383
Sequence GGGACCTCATTAGAAGGCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939992470_939992487 26 Left 939992470 2:148888361-148888383 CCAGCGCCTTCTAATGAGGTCCC No data
Right 939992487 2:148888410-148888432 TTAGGGGGCCCTGTGGTGGGAGG No data
939992470_939992481 11 Left 939992470 2:148888361-148888383 CCAGCGCCTTCTAATGAGGTCCC No data
Right 939992481 2:148888395-148888417 GGACAAAAGCGCCCATTAGGGGG No data
939992470_939992472 -10 Left 939992470 2:148888361-148888383 CCAGCGCCTTCTAATGAGGTCCC No data
Right 939992472 2:148888374-148888396 ATGAGGTCCCTCTGCCCCGCAGG No data
939992470_939992488 29 Left 939992470 2:148888361-148888383 CCAGCGCCTTCTAATGAGGTCCC No data
Right 939992488 2:148888413-148888435 GGGGGCCCTGTGGTGGGAGGCGG No data
939992470_939992484 22 Left 939992470 2:148888361-148888383 CCAGCGCCTTCTAATGAGGTCCC No data
Right 939992484 2:148888406-148888428 CCCATTAGGGGGCCCTGTGGTGG No data
939992470_939992478 8 Left 939992470 2:148888361-148888383 CCAGCGCCTTCTAATGAGGTCCC No data
Right 939992478 2:148888392-148888414 GCAGGACAAAAGCGCCCATTAGG No data
939992470_939992482 19 Left 939992470 2:148888361-148888383 CCAGCGCCTTCTAATGAGGTCCC No data
Right 939992482 2:148888403-148888425 GCGCCCATTAGGGGGCCCTGTGG No data
939992470_939992479 9 Left 939992470 2:148888361-148888383 CCAGCGCCTTCTAATGAGGTCCC No data
Right 939992479 2:148888393-148888415 CAGGACAAAAGCGCCCATTAGGG No data
939992470_939992486 23 Left 939992470 2:148888361-148888383 CCAGCGCCTTCTAATGAGGTCCC No data
Right 939992486 2:148888407-148888429 CCATTAGGGGGCCCTGTGGTGGG No data
939992470_939992480 10 Left 939992470 2:148888361-148888383 CCAGCGCCTTCTAATGAGGTCCC No data
Right 939992480 2:148888394-148888416 AGGACAAAAGCGCCCATTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939992470 Original CRISPR GGGACCTCATTAGAAGGCGC TGG (reversed) Intronic
No off target data available for this crispr