ID: 939992471

View in Genome Browser
Species Human (GRCh38)
Location 2:148888367-148888389
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939992471_939992486 17 Left 939992471 2:148888367-148888389 CCTTCTAATGAGGTCCCTCTGCC No data
Right 939992486 2:148888407-148888429 CCATTAGGGGGCCCTGTGGTGGG No data
939992471_939992487 20 Left 939992471 2:148888367-148888389 CCTTCTAATGAGGTCCCTCTGCC No data
Right 939992487 2:148888410-148888432 TTAGGGGGCCCTGTGGTGGGAGG No data
939992471_939992478 2 Left 939992471 2:148888367-148888389 CCTTCTAATGAGGTCCCTCTGCC No data
Right 939992478 2:148888392-148888414 GCAGGACAAAAGCGCCCATTAGG No data
939992471_939992488 23 Left 939992471 2:148888367-148888389 CCTTCTAATGAGGTCCCTCTGCC No data
Right 939992488 2:148888413-148888435 GGGGGCCCTGTGGTGGGAGGCGG No data
939992471_939992482 13 Left 939992471 2:148888367-148888389 CCTTCTAATGAGGTCCCTCTGCC No data
Right 939992482 2:148888403-148888425 GCGCCCATTAGGGGGCCCTGTGG No data
939992471_939992480 4 Left 939992471 2:148888367-148888389 CCTTCTAATGAGGTCCCTCTGCC No data
Right 939992480 2:148888394-148888416 AGGACAAAAGCGCCCATTAGGGG No data
939992471_939992479 3 Left 939992471 2:148888367-148888389 CCTTCTAATGAGGTCCCTCTGCC No data
Right 939992479 2:148888393-148888415 CAGGACAAAAGCGCCCATTAGGG No data
939992471_939992484 16 Left 939992471 2:148888367-148888389 CCTTCTAATGAGGTCCCTCTGCC No data
Right 939992484 2:148888406-148888428 CCCATTAGGGGGCCCTGTGGTGG No data
939992471_939992481 5 Left 939992471 2:148888367-148888389 CCTTCTAATGAGGTCCCTCTGCC No data
Right 939992481 2:148888395-148888417 GGACAAAAGCGCCCATTAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939992471 Original CRISPR GGCAGAGGGACCTCATTAGA AGG (reversed) Intronic