ID: 939992474

View in Genome Browser
Species Human (GRCh38)
Location 2:148888382-148888404
Sequence GCTTTTGTCCTGCGGGGCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939992474_939992488 8 Left 939992474 2:148888382-148888404 CCTCTGCCCCGCAGGACAAAAGC No data
Right 939992488 2:148888413-148888435 GGGGGCCCTGTGGTGGGAGGCGG No data
939992474_939992484 1 Left 939992474 2:148888382-148888404 CCTCTGCCCCGCAGGACAAAAGC No data
Right 939992484 2:148888406-148888428 CCCATTAGGGGGCCCTGTGGTGG No data
939992474_939992482 -2 Left 939992474 2:148888382-148888404 CCTCTGCCCCGCAGGACAAAAGC No data
Right 939992482 2:148888403-148888425 GCGCCCATTAGGGGGCCCTGTGG No data
939992474_939992481 -10 Left 939992474 2:148888382-148888404 CCTCTGCCCCGCAGGACAAAAGC No data
Right 939992481 2:148888395-148888417 GGACAAAAGCGCCCATTAGGGGG No data
939992474_939992486 2 Left 939992474 2:148888382-148888404 CCTCTGCCCCGCAGGACAAAAGC No data
Right 939992486 2:148888407-148888429 CCATTAGGGGGCCCTGTGGTGGG No data
939992474_939992487 5 Left 939992474 2:148888382-148888404 CCTCTGCCCCGCAGGACAAAAGC No data
Right 939992487 2:148888410-148888432 TTAGGGGGCCCTGTGGTGGGAGG No data
939992474_939992491 21 Left 939992474 2:148888382-148888404 CCTCTGCCCCGCAGGACAAAAGC No data
Right 939992491 2:148888426-148888448 TGGGAGGCGGCCACTCCGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939992474 Original CRISPR GCTTTTGTCCTGCGGGGCAG AGG (reversed) Intronic
No off target data available for this crispr