ID: 939992475

View in Genome Browser
Species Human (GRCh38)
Location 2:148888388-148888410
Sequence ATGGGCGCTTTTGTCCTGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939992475_939992486 -4 Left 939992475 2:148888388-148888410 CCCCGCAGGACAAAAGCGCCCAT No data
Right 939992486 2:148888407-148888429 CCATTAGGGGGCCCTGTGGTGGG No data
939992475_939992493 25 Left 939992475 2:148888388-148888410 CCCCGCAGGACAAAAGCGCCCAT No data
Right 939992493 2:148888436-148888458 CCACTCCGCTTGGCGCCGTGAGG No data
939992475_939992488 2 Left 939992475 2:148888388-148888410 CCCCGCAGGACAAAAGCGCCCAT No data
Right 939992488 2:148888413-148888435 GGGGGCCCTGTGGTGGGAGGCGG No data
939992475_939992484 -5 Left 939992475 2:148888388-148888410 CCCCGCAGGACAAAAGCGCCCAT No data
Right 939992484 2:148888406-148888428 CCCATTAGGGGGCCCTGTGGTGG No data
939992475_939992491 15 Left 939992475 2:148888388-148888410 CCCCGCAGGACAAAAGCGCCCAT No data
Right 939992491 2:148888426-148888448 TGGGAGGCGGCCACTCCGCTTGG No data
939992475_939992487 -1 Left 939992475 2:148888388-148888410 CCCCGCAGGACAAAAGCGCCCAT No data
Right 939992487 2:148888410-148888432 TTAGGGGGCCCTGTGGTGGGAGG No data
939992475_939992482 -8 Left 939992475 2:148888388-148888410 CCCCGCAGGACAAAAGCGCCCAT No data
Right 939992482 2:148888403-148888425 GCGCCCATTAGGGGGCCCTGTGG No data
939992475_939992494 26 Left 939992475 2:148888388-148888410 CCCCGCAGGACAAAAGCGCCCAT No data
Right 939992494 2:148888437-148888459 CACTCCGCTTGGCGCCGTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939992475 Original CRISPR ATGGGCGCTTTTGTCCTGCG GGG (reversed) Intronic