ID: 939992476

View in Genome Browser
Species Human (GRCh38)
Location 2:148888389-148888411
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939992476_939992487 -2 Left 939992476 2:148888389-148888411 CCCGCAGGACAAAAGCGCCCATT No data
Right 939992487 2:148888410-148888432 TTAGGGGGCCCTGTGGTGGGAGG No data
939992476_939992484 -6 Left 939992476 2:148888389-148888411 CCCGCAGGACAAAAGCGCCCATT No data
Right 939992484 2:148888406-148888428 CCCATTAGGGGGCCCTGTGGTGG No data
939992476_939992494 25 Left 939992476 2:148888389-148888411 CCCGCAGGACAAAAGCGCCCATT No data
Right 939992494 2:148888437-148888459 CACTCCGCTTGGCGCCGTGAGGG No data
939992476_939992486 -5 Left 939992476 2:148888389-148888411 CCCGCAGGACAAAAGCGCCCATT No data
Right 939992486 2:148888407-148888429 CCATTAGGGGGCCCTGTGGTGGG No data
939992476_939992482 -9 Left 939992476 2:148888389-148888411 CCCGCAGGACAAAAGCGCCCATT No data
Right 939992482 2:148888403-148888425 GCGCCCATTAGGGGGCCCTGTGG No data
939992476_939992488 1 Left 939992476 2:148888389-148888411 CCCGCAGGACAAAAGCGCCCATT No data
Right 939992488 2:148888413-148888435 GGGGGCCCTGTGGTGGGAGGCGG No data
939992476_939992491 14 Left 939992476 2:148888389-148888411 CCCGCAGGACAAAAGCGCCCATT No data
Right 939992491 2:148888426-148888448 TGGGAGGCGGCCACTCCGCTTGG No data
939992476_939992493 24 Left 939992476 2:148888389-148888411 CCCGCAGGACAAAAGCGCCCATT No data
Right 939992493 2:148888436-148888458 CCACTCCGCTTGGCGCCGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939992476 Original CRISPR AATGGGCGCTTTTGTCCTGC GGG (reversed) Intronic
No off target data available for this crispr