ID: 939992477

View in Genome Browser
Species Human (GRCh38)
Location 2:148888390-148888412
Sequence TAATGGGCGCTTTTGTCCTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939992477_939992482 -10 Left 939992477 2:148888390-148888412 CCGCAGGACAAAAGCGCCCATTA No data
Right 939992482 2:148888403-148888425 GCGCCCATTAGGGGGCCCTGTGG No data
939992477_939992494 24 Left 939992477 2:148888390-148888412 CCGCAGGACAAAAGCGCCCATTA No data
Right 939992494 2:148888437-148888459 CACTCCGCTTGGCGCCGTGAGGG No data
939992477_939992488 0 Left 939992477 2:148888390-148888412 CCGCAGGACAAAAGCGCCCATTA No data
Right 939992488 2:148888413-148888435 GGGGGCCCTGTGGTGGGAGGCGG No data
939992477_939992484 -7 Left 939992477 2:148888390-148888412 CCGCAGGACAAAAGCGCCCATTA No data
Right 939992484 2:148888406-148888428 CCCATTAGGGGGCCCTGTGGTGG No data
939992477_939992491 13 Left 939992477 2:148888390-148888412 CCGCAGGACAAAAGCGCCCATTA No data
Right 939992491 2:148888426-148888448 TGGGAGGCGGCCACTCCGCTTGG No data
939992477_939992487 -3 Left 939992477 2:148888390-148888412 CCGCAGGACAAAAGCGCCCATTA No data
Right 939992487 2:148888410-148888432 TTAGGGGGCCCTGTGGTGGGAGG No data
939992477_939992493 23 Left 939992477 2:148888390-148888412 CCGCAGGACAAAAGCGCCCATTA No data
Right 939992493 2:148888436-148888458 CCACTCCGCTTGGCGCCGTGAGG No data
939992477_939992486 -6 Left 939992477 2:148888390-148888412 CCGCAGGACAAAAGCGCCCATTA No data
Right 939992486 2:148888407-148888429 CCATTAGGGGGCCCTGTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939992477 Original CRISPR TAATGGGCGCTTTTGTCCTG CGG (reversed) Intronic