ID: 939992478

View in Genome Browser
Species Human (GRCh38)
Location 2:148888392-148888414
Sequence GCAGGACAAAAGCGCCCATT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939992468_939992478 17 Left 939992468 2:148888352-148888374 CCTTTAGCACCAGCGCCTTCTAA No data
Right 939992478 2:148888392-148888414 GCAGGACAAAAGCGCCCATTAGG No data
939992467_939992478 18 Left 939992467 2:148888351-148888373 CCCTTTAGCACCAGCGCCTTCTA No data
Right 939992478 2:148888392-148888414 GCAGGACAAAAGCGCCCATTAGG No data
939992470_939992478 8 Left 939992470 2:148888361-148888383 CCAGCGCCTTCTAATGAGGTCCC No data
Right 939992478 2:148888392-148888414 GCAGGACAAAAGCGCCCATTAGG No data
939992471_939992478 2 Left 939992471 2:148888367-148888389 CCTTCTAATGAGGTCCCTCTGCC No data
Right 939992478 2:148888392-148888414 GCAGGACAAAAGCGCCCATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939992478 Original CRISPR GCAGGACAAAAGCGCCCATT AGG Intronic
No off target data available for this crispr