ID: 939992480

View in Genome Browser
Species Human (GRCh38)
Location 2:148888394-148888416
Sequence AGGACAAAAGCGCCCATTAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939992470_939992480 10 Left 939992470 2:148888361-148888383 CCAGCGCCTTCTAATGAGGTCCC No data
Right 939992480 2:148888394-148888416 AGGACAAAAGCGCCCATTAGGGG No data
939992471_939992480 4 Left 939992471 2:148888367-148888389 CCTTCTAATGAGGTCCCTCTGCC No data
Right 939992480 2:148888394-148888416 AGGACAAAAGCGCCCATTAGGGG No data
939992468_939992480 19 Left 939992468 2:148888352-148888374 CCTTTAGCACCAGCGCCTTCTAA No data
Right 939992480 2:148888394-148888416 AGGACAAAAGCGCCCATTAGGGG No data
939992467_939992480 20 Left 939992467 2:148888351-148888373 CCCTTTAGCACCAGCGCCTTCTA No data
Right 939992480 2:148888394-148888416 AGGACAAAAGCGCCCATTAGGGG No data
939992473_939992480 -10 Left 939992473 2:148888381-148888403 CCCTCTGCCCCGCAGGACAAAAG No data
Right 939992480 2:148888394-148888416 AGGACAAAAGCGCCCATTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939992480 Original CRISPR AGGACAAAAGCGCCCATTAG GGG Intronic
No off target data available for this crispr