ID: 939992481

View in Genome Browser
Species Human (GRCh38)
Location 2:148888395-148888417
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939992468_939992481 20 Left 939992468 2:148888352-148888374 CCTTTAGCACCAGCGCCTTCTAA No data
Right 939992481 2:148888395-148888417 GGACAAAAGCGCCCATTAGGGGG No data
939992470_939992481 11 Left 939992470 2:148888361-148888383 CCAGCGCCTTCTAATGAGGTCCC No data
Right 939992481 2:148888395-148888417 GGACAAAAGCGCCCATTAGGGGG No data
939992474_939992481 -10 Left 939992474 2:148888382-148888404 CCTCTGCCCCGCAGGACAAAAGC No data
Right 939992481 2:148888395-148888417 GGACAAAAGCGCCCATTAGGGGG No data
939992471_939992481 5 Left 939992471 2:148888367-148888389 CCTTCTAATGAGGTCCCTCTGCC No data
Right 939992481 2:148888395-148888417 GGACAAAAGCGCCCATTAGGGGG No data
939992467_939992481 21 Left 939992467 2:148888351-148888373 CCCTTTAGCACCAGCGCCTTCTA No data
Right 939992481 2:148888395-148888417 GGACAAAAGCGCCCATTAGGGGG No data
939992473_939992481 -9 Left 939992473 2:148888381-148888403 CCCTCTGCCCCGCAGGACAAAAG No data
Right 939992481 2:148888395-148888417 GGACAAAAGCGCCCATTAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type