ID: 939992482

View in Genome Browser
Species Human (GRCh38)
Location 2:148888403-148888425
Sequence GCGCCCATTAGGGGGCCCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939992473_939992482 -1 Left 939992473 2:148888381-148888403 CCCTCTGCCCCGCAGGACAAAAG No data
Right 939992482 2:148888403-148888425 GCGCCCATTAGGGGGCCCTGTGG No data
939992477_939992482 -10 Left 939992477 2:148888390-148888412 CCGCAGGACAAAAGCGCCCATTA No data
Right 939992482 2:148888403-148888425 GCGCCCATTAGGGGGCCCTGTGG No data
939992470_939992482 19 Left 939992470 2:148888361-148888383 CCAGCGCCTTCTAATGAGGTCCC No data
Right 939992482 2:148888403-148888425 GCGCCCATTAGGGGGCCCTGTGG No data
939992474_939992482 -2 Left 939992474 2:148888382-148888404 CCTCTGCCCCGCAGGACAAAAGC No data
Right 939992482 2:148888403-148888425 GCGCCCATTAGGGGGCCCTGTGG No data
939992476_939992482 -9 Left 939992476 2:148888389-148888411 CCCGCAGGACAAAAGCGCCCATT No data
Right 939992482 2:148888403-148888425 GCGCCCATTAGGGGGCCCTGTGG No data
939992467_939992482 29 Left 939992467 2:148888351-148888373 CCCTTTAGCACCAGCGCCTTCTA No data
Right 939992482 2:148888403-148888425 GCGCCCATTAGGGGGCCCTGTGG No data
939992471_939992482 13 Left 939992471 2:148888367-148888389 CCTTCTAATGAGGTCCCTCTGCC No data
Right 939992482 2:148888403-148888425 GCGCCCATTAGGGGGCCCTGTGG No data
939992475_939992482 -8 Left 939992475 2:148888388-148888410 CCCCGCAGGACAAAAGCGCCCAT No data
Right 939992482 2:148888403-148888425 GCGCCCATTAGGGGGCCCTGTGG No data
939992468_939992482 28 Left 939992468 2:148888352-148888374 CCTTTAGCACCAGCGCCTTCTAA No data
Right 939992482 2:148888403-148888425 GCGCCCATTAGGGGGCCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939992482 Original CRISPR GCGCCCATTAGGGGGCCCTG TGG Intronic
No off target data available for this crispr