ID: 939992486

View in Genome Browser
Species Human (GRCh38)
Location 2:148888407-148888429
Sequence CCATTAGGGGGCCCTGTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939992470_939992486 23 Left 939992470 2:148888361-148888383 CCAGCGCCTTCTAATGAGGTCCC No data
Right 939992486 2:148888407-148888429 CCATTAGGGGGCCCTGTGGTGGG No data
939992477_939992486 -6 Left 939992477 2:148888390-148888412 CCGCAGGACAAAAGCGCCCATTA No data
Right 939992486 2:148888407-148888429 CCATTAGGGGGCCCTGTGGTGGG No data
939992476_939992486 -5 Left 939992476 2:148888389-148888411 CCCGCAGGACAAAAGCGCCCATT No data
Right 939992486 2:148888407-148888429 CCATTAGGGGGCCCTGTGGTGGG No data
939992474_939992486 2 Left 939992474 2:148888382-148888404 CCTCTGCCCCGCAGGACAAAAGC No data
Right 939992486 2:148888407-148888429 CCATTAGGGGGCCCTGTGGTGGG No data
939992471_939992486 17 Left 939992471 2:148888367-148888389 CCTTCTAATGAGGTCCCTCTGCC No data
Right 939992486 2:148888407-148888429 CCATTAGGGGGCCCTGTGGTGGG No data
939992475_939992486 -4 Left 939992475 2:148888388-148888410 CCCCGCAGGACAAAAGCGCCCAT No data
Right 939992486 2:148888407-148888429 CCATTAGGGGGCCCTGTGGTGGG No data
939992473_939992486 3 Left 939992473 2:148888381-148888403 CCCTCTGCCCCGCAGGACAAAAG No data
Right 939992486 2:148888407-148888429 CCATTAGGGGGCCCTGTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939992486 Original CRISPR CCATTAGGGGGCCCTGTGGT GGG Intronic