ID: 939992491

View in Genome Browser
Species Human (GRCh38)
Location 2:148888426-148888448
Sequence TGGGAGGCGGCCACTCCGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939992477_939992491 13 Left 939992477 2:148888390-148888412 CCGCAGGACAAAAGCGCCCATTA No data
Right 939992491 2:148888426-148888448 TGGGAGGCGGCCACTCCGCTTGG No data
939992485_939992491 -4 Left 939992485 2:148888407-148888429 CCATTAGGGGGCCCTGTGGTGGG No data
Right 939992491 2:148888426-148888448 TGGGAGGCGGCCACTCCGCTTGG No data
939992476_939992491 14 Left 939992476 2:148888389-148888411 CCCGCAGGACAAAAGCGCCCATT No data
Right 939992491 2:148888426-148888448 TGGGAGGCGGCCACTCCGCTTGG No data
939992474_939992491 21 Left 939992474 2:148888382-148888404 CCTCTGCCCCGCAGGACAAAAGC No data
Right 939992491 2:148888426-148888448 TGGGAGGCGGCCACTCCGCTTGG No data
939992473_939992491 22 Left 939992473 2:148888381-148888403 CCCTCTGCCCCGCAGGACAAAAG No data
Right 939992491 2:148888426-148888448 TGGGAGGCGGCCACTCCGCTTGG No data
939992483_939992491 -3 Left 939992483 2:148888406-148888428 CCCATTAGGGGGCCCTGTGGTGG No data
Right 939992491 2:148888426-148888448 TGGGAGGCGGCCACTCCGCTTGG No data
939992475_939992491 15 Left 939992475 2:148888388-148888410 CCCCGCAGGACAAAAGCGCCCAT No data
Right 939992491 2:148888426-148888448 TGGGAGGCGGCCACTCCGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939992491 Original CRISPR TGGGAGGCGGCCACTCCGCT TGG Intronic