ID: 939993457

View in Genome Browser
Species Human (GRCh38)
Location 2:148898173-148898195
Sequence ATGGAGACCTTCAGGCACCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939993446_939993457 18 Left 939993446 2:148898132-148898154 CCCTCCCTTCCTGCCAAATGTCC No data
Right 939993457 2:148898173-148898195 ATGGAGACCTTCAGGCACCTAGG No data
939993448_939993457 14 Left 939993448 2:148898136-148898158 CCCTTCCTGCCAAATGTCCTGTC No data
Right 939993457 2:148898173-148898195 ATGGAGACCTTCAGGCACCTAGG No data
939993453_939993457 -3 Left 939993453 2:148898153-148898175 CCTGTCTAGTCCACATAGGAATG No data
Right 939993457 2:148898173-148898195 ATGGAGACCTTCAGGCACCTAGG No data
939993447_939993457 17 Left 939993447 2:148898133-148898155 CCTCCCTTCCTGCCAAATGTCCT No data
Right 939993457 2:148898173-148898195 ATGGAGACCTTCAGGCACCTAGG No data
939993451_939993457 5 Left 939993451 2:148898145-148898167 CCAAATGTCCTGTCTAGTCCACA No data
Right 939993457 2:148898173-148898195 ATGGAGACCTTCAGGCACCTAGG No data
939993445_939993457 23 Left 939993445 2:148898127-148898149 CCTAGCCCTCCCTTCCTGCCAAA No data
Right 939993457 2:148898173-148898195 ATGGAGACCTTCAGGCACCTAGG No data
939993450_939993457 9 Left 939993450 2:148898141-148898163 CCTGCCAAATGTCCTGTCTAGTC No data
Right 939993457 2:148898173-148898195 ATGGAGACCTTCAGGCACCTAGG No data
939993449_939993457 13 Left 939993449 2:148898137-148898159 CCTTCCTGCCAAATGTCCTGTCT No data
Right 939993457 2:148898173-148898195 ATGGAGACCTTCAGGCACCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939993457 Original CRISPR ATGGAGACCTTCAGGCACCT AGG Intronic
No off target data available for this crispr