ID: 939995424

View in Genome Browser
Species Human (GRCh38)
Location 2:148915246-148915268
Sequence CACCCTCCTCTAGCATCCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939995420_939995424 4 Left 939995420 2:148915219-148915241 CCTGTATCGTACACCATTTGAGA No data
Right 939995424 2:148915246-148915268 CACCCTCCTCTAGCATCCCTGGG No data
939995422_939995424 -9 Left 939995422 2:148915232-148915254 CCATTTGAGAGTGGCACCCTCCT No data
Right 939995424 2:148915246-148915268 CACCCTCCTCTAGCATCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939995424 Original CRISPR CACCCTCCTCTAGCATCCCT GGG Intronic
No off target data available for this crispr