ID: 939997134

View in Genome Browser
Species Human (GRCh38)
Location 2:148930444-148930466
Sequence GAAACTGCACAGAGGAAGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939997130_939997134 20 Left 939997130 2:148930401-148930423 CCACTTGATAGGTAAGGAGAGGT No data
Right 939997134 2:148930444-148930466 GAAACTGCACAGAGGAAGTTTGG No data
939997128_939997134 21 Left 939997128 2:148930400-148930422 CCCACTTGATAGGTAAGGAGAGG No data
Right 939997134 2:148930444-148930466 GAAACTGCACAGAGGAAGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939997134 Original CRISPR GAAACTGCACAGAGGAAGTT TGG Intronic
No off target data available for this crispr