ID: 939998568

View in Genome Browser
Species Human (GRCh38)
Location 2:148943667-148943689
Sequence CAGCACTTGGGGCAGCTATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939998568_939998572 -6 Left 939998568 2:148943667-148943689 CCTTATAGCTGCCCCAAGTGCTG No data
Right 939998572 2:148943684-148943706 GTGCTGCCTGCTACCTAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939998568 Original CRISPR CAGCACTTGGGGCAGCTATA AGG (reversed) Intronic
No off target data available for this crispr