ID: 940005808

View in Genome Browser
Species Human (GRCh38)
Location 2:149008504-149008526
Sequence CACCGTGGGAGGACCGGGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940005804_940005808 -10 Left 940005804 2:149008491-149008513 CCTTGCTTCATTGCACCGTGGGA No data
Right 940005808 2:149008504-149008526 CACCGTGGGAGGACCGGGACTGG No data
940005800_940005808 24 Left 940005800 2:149008457-149008479 CCTTTATTTTTACAGATGGGGAA No data
Right 940005808 2:149008504-149008526 CACCGTGGGAGGACCGGGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940005808 Original CRISPR CACCGTGGGAGGACCGGGAC TGG Intronic
No off target data available for this crispr