ID: 940006556

View in Genome Browser
Species Human (GRCh38)
Location 2:149013791-149013813
Sequence GGCTCCAAACAACCAAATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940006553_940006556 -3 Left 940006553 2:149013771-149013793 CCAGTCCCATATTTTATGTAGGC No data
Right 940006556 2:149013791-149013813 GGCTCCAAACAACCAAATGCTGG No data
940006551_940006556 11 Left 940006551 2:149013757-149013779 CCAACAAAGGTCTGCCAGTCCCA No data
Right 940006556 2:149013791-149013813 GGCTCCAAACAACCAAATGCTGG No data
940006554_940006556 -8 Left 940006554 2:149013776-149013798 CCCATATTTTATGTAGGCTCCAA No data
Right 940006556 2:149013791-149013813 GGCTCCAAACAACCAAATGCTGG No data
940006549_940006556 26 Left 940006549 2:149013742-149013764 CCTTCTTCATGGGTTCCAACAAA No data
Right 940006556 2:149013791-149013813 GGCTCCAAACAACCAAATGCTGG No data
940006555_940006556 -9 Left 940006555 2:149013777-149013799 CCATATTTTATGTAGGCTCCAAA No data
Right 940006556 2:149013791-149013813 GGCTCCAAACAACCAAATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940006556 Original CRISPR GGCTCCAAACAACCAAATGC TGG Intronic
No off target data available for this crispr