ID: 940007374

View in Genome Browser
Species Human (GRCh38)
Location 2:149020376-149020398
Sequence TGCTTAGTTTAGTCACCTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 93}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940007374_940007379 -4 Left 940007374 2:149020376-149020398 CCTTGAGGTGACTAAACTAAGCA 0: 1
1: 0
2: 1
3: 9
4: 93
Right 940007379 2:149020395-149020417 AGCAGGTGGGGCCTCCTTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940007374 Original CRISPR TGCTTAGTTTAGTCACCTCA AGG (reversed) Intronic
905029146 1:34869852-34869874 TACTTAGTTTACTCATCTCTAGG - Intronic
905301865 1:36991049-36991071 TGCTTTCCTTAGGCACCTCAGGG - Intronic
909882046 1:80891946-80891968 TGCTTTGATTAGTTTCCTCAAGG + Intergenic
910742834 1:90539752-90539774 CGCTTAGCATAGTGACCTCAAGG + Intergenic
919886453 1:201938541-201938563 TGGTTAGAATAGTCTCCTCAGGG - Intronic
922990250 1:229901366-229901388 TGCTTGCTATAGTCACCTTAGGG - Intergenic
1064980876 10:21165550-21165572 TGATAATATTAGTCACCTCAGGG - Intronic
1067421115 10:46148798-46148820 TGCTTTGTTTATTCACCCAAAGG - Intergenic
1067506452 10:46855253-46855275 TGCTTTGTTTATTCACCCAAAGG - Intergenic
1071328462 10:84539347-84539369 TGCTTTATTTAGTCATTTCATGG - Intergenic
1074606430 10:114973466-114973488 TGCTTTCTTTAGTCAGCTCATGG - Intronic
1084466737 11:69327769-69327791 TGCTTGGTTTTGTCACTGCAAGG + Intronic
1085241757 11:75062325-75062347 TGCTTAATTAAGGCTCCTCATGG - Intergenic
1086318262 11:85616084-85616106 TGCTTAATGTAGTCAACTGATGG + Intronic
1086861434 11:91929277-91929299 TTCTTTGTTTATTCAACTCATGG + Intergenic
1097484660 12:60180585-60180607 TGCATAATATAGTGACCTCAGGG + Intergenic
1098165786 12:67696133-67696155 TGCTTTGTTTGAACACCTCAAGG + Intergenic
1100494620 12:95112903-95112925 TTTGTAGTTTAGTCACTTCATGG + Intronic
1104177833 12:126350287-126350309 TCCTTGGTCTAGTCTCCTCATGG + Intergenic
1105986565 13:25573016-25573038 TGCTTATTTTAGTCAACAAAGGG + Intronic
1109638887 13:65161040-65161062 TGGGTATTTTAGACACCTCAGGG - Intergenic
1110408830 13:75182021-75182043 TGCTTAGTTTAGCATCCTTACGG + Intergenic
1114815850 14:25957044-25957066 TCCTTACTTTTGTCACTTCATGG + Intergenic
1119252281 14:73167090-73167112 TGATTTGTTTATTCAGCTCATGG + Intronic
1119492634 14:75050265-75050287 GGTTAAGTATAGTCACCTCAGGG + Intronic
1123878729 15:24653420-24653442 TGCTTAGGATAATGACCTCAAGG - Intergenic
1124357917 15:29011116-29011138 TGCTTAGTACAGTGTCCTCAAGG + Intronic
1124365500 15:29068481-29068503 TGCTTAGCTTGGTCAGCGCAGGG + Intronic
1124949728 15:34306150-34306172 TGTTTATCTTTGTCACCTCATGG + Intronic
1128300421 15:66563468-66563490 TGCTTAGTTGAGTCCCCTTTGGG + Intronic
1131867739 15:96730102-96730124 TGCTGAATTTAGTCACCTAGGGG + Intergenic
1135517156 16:23145637-23145659 TTCTTAGGTTTGTCACCTCATGG - Intronic
1140264681 16:73410078-73410100 TGTTGACTTTAGTCACCTTATGG - Intergenic
1140344709 16:74201872-74201894 TGCTTAGTTAAGGCACCCCATGG - Intergenic
1150663881 17:67111897-67111919 TGCATAGTTTGGTCACATGAAGG + Intronic
1158118666 18:54025151-54025173 TGCTCTGTTCAGTCACCTCTTGG - Intergenic
1161669954 19:5601383-5601405 TGCTTACTTTTGTCACCTCATGG + Intronic
1161753674 19:6115690-6115712 AGCTCAGTTGAGCCACCTCATGG + Intronic
1167979726 19:53263922-53263944 TCATTAGTTTATTCACGTCATGG - Intergenic
926996789 2:18744195-18744217 TTCTTGGTTTAGGAACCTCAGGG - Intergenic
930044765 2:47159858-47159880 GGCTTAGTGTAGTCACCTTTTGG - Intronic
931103346 2:59027457-59027479 CACTTAGTTGAGACACCTCAAGG - Intergenic
939233822 2:139466026-139466048 TGCTTGGCTCATTCACCTCAAGG + Intergenic
940007374 2:149020376-149020398 TGCTTAGTTTAGTCACCTCAAGG - Intronic
940383021 2:153037425-153037447 TGCTTAGTGTAATGACCTCGAGG + Intergenic
940418848 2:153455373-153455395 TGCCTCGTTTACTCAGCTCACGG + Intergenic
940994120 2:160128689-160128711 TGCTCAGTCTAGTCACCTGGGGG - Intronic
942691365 2:178588796-178588818 TGCTTACTTTAGTGACTTCTGGG + Exonic
944822993 2:203450117-203450139 TGCTTATTTTATTGAGCTCATGG - Intronic
1170052509 20:12161585-12161607 TGCTTAATATAGTTAACTCAAGG - Intergenic
1174083139 20:47984900-47984922 TGCATATTTGAGTCACCTGAGGG - Intergenic
1181576794 22:23800459-23800481 TGCTGAGTAAAGTCATCTCACGG + Intronic
949698199 3:6723628-6723650 TATATAGTTAAGTCACCTCAGGG - Intergenic
950393321 3:12714064-12714086 TCCTTAGGCAAGTCACCTCATGG + Intergenic
951708405 3:25566620-25566642 TGCTTGGTTCAGTTACTTCATGG + Intronic
951761571 3:26153099-26153121 TGCTTATTTTAGCTTCCTCAAGG + Intergenic
952080602 3:29753136-29753158 TGATTAGATTACTAACCTCAGGG + Intronic
952181239 3:30918535-30918557 TTTTTATTTTGGTCACCTCATGG - Intergenic
952541709 3:34373836-34373858 TTCTTATTTTACTCACCTGAGGG + Intergenic
957650065 3:82989552-82989574 TGATTATTTCAGTGACCTCACGG - Intergenic
958167143 3:89890509-89890531 CTCTTATTTTAGTCCCCTCAAGG - Intergenic
958603869 3:96333021-96333043 TGCTAATTTTAGTCTCCTCATGG - Intergenic
959107804 3:102085055-102085077 TGCTTAGCTTAATGTCCTCAGGG + Intergenic
963908491 3:150794298-150794320 GGCTGAGTTTAGCCACCACAGGG + Intergenic
973073709 4:45896989-45897011 TGCTTATTTTAGCTTCCTCAAGG + Intergenic
973101403 4:46275760-46275782 TCCTCAGTTAAATCACCTCAAGG - Intronic
973192904 4:47407311-47407333 TTCCCAGTTTAGTCACCTAATGG + Intronic
973669230 4:53198193-53198215 TGTTTTGTTTAGTGACCTTAAGG - Intronic
980425757 4:132626510-132626532 TGTTTAGTTTAGTTACCTAGGGG + Intergenic
983440710 4:167780190-167780212 TGCTTTGGTTATTCATCTCATGG + Intergenic
989800347 5:45530712-45530734 TGCTTAGTTTATTCACTTTTTGG - Intronic
991434173 5:66579344-66579366 TGCTTTGTTTAGTCAACACATGG + Intergenic
993456088 5:88129356-88129378 TTCTTAGTGTAGTCACATTAGGG + Intergenic
993935532 5:93996408-93996430 TGCATTGTTTACTGACCTCAGGG + Intronic
995690624 5:114822665-114822687 AGATTTGTTTAGTCTCCTCAAGG + Intergenic
997988242 5:138521983-138522005 TTCTTAGTTTAGTCACAACATGG + Intronic
998369794 5:141653722-141653744 TCCTTACTTCAGTTACCTCATGG + Exonic
1000298164 5:159930708-159930730 TTATTAGTTTAGTTACCTCAAGG + Intronic
1002523295 5:179803056-179803078 GGCAAAGTTCAGTCACCTCAGGG + Intronic
1002866422 6:1125928-1125950 TGCTTAGTTTGGCGACCTTAAGG + Intergenic
1005778095 6:29159933-29159955 GGCTTAGTTTAGGCCCCGCAGGG - Intergenic
1005778766 6:29165946-29165968 GGCTTAGTTTAGGCCCCGCAGGG + Intergenic
1011007064 6:82657456-82657478 TGCTTAGCTTAATGTCCTCAAGG + Intergenic
1011679703 6:89771097-89771119 TGCTTATTTTAGTTTCCTCAGGG - Intronic
1014649299 6:124016545-124016567 TGCTCAGTTTTCTCCCCTCAAGG + Intronic
1016134182 6:140518621-140518643 TGCTTAGTATAATGTCCTCAGGG + Intergenic
1020534226 7:9373854-9373876 TGCTTACTTTAGTCTCCTGCAGG + Intergenic
1023929109 7:44694095-44694117 TGTCTAGATGAGTCACCTCAGGG + Intronic
1024822176 7:53344764-53344786 GGTTTAGTTTTGTCAGCTCATGG + Intergenic
1027928354 7:84497346-84497368 TCCTTGGCTTGGTCACCTCATGG - Intergenic
1030405860 7:109112284-109112306 AGATTAGTTTAGCCACCTAAAGG + Intergenic
1031530437 7:122869066-122869088 TGCATAGTTTATTCACTTGATGG - Intronic
1033272467 7:139944950-139944972 TCCTTAGTTTATTCACTTCTAGG - Intronic
1034381293 7:150695892-150695914 TGGTTCTTTTTGTCACCTCAGGG - Intergenic
1038358698 8:26855914-26855936 TGCTGTGTTCTGTCACCTCATGG - Intronic
1048650525 8:136471115-136471137 TGCTTTGTATAGTTGCCTCATGG + Intergenic
1060912601 9:127362830-127362852 TGCTTAGATAAGTTACCTCCTGG + Intronic
1188079519 X:25819362-25819384 TGCTGAGTTGACTCAACTCATGG - Intergenic
1189839778 X:45062550-45062572 TTCTGAGTTTAGTCATTTCAGGG + Intronic
1194745277 X:97621357-97621379 TTCTTTGTTTAGTCCACTCAAGG + Intergenic
1196059130 X:111388610-111388632 TGCATAGTATAGTCTCCTCTTGG - Intronic
1196213586 X:113024036-113024058 TGCTTAATGTAGGCACCCCATGG + Intergenic
1198634821 X:138685081-138685103 TGCTTCGTTTAGCAACCACAAGG + Intronic
1200322820 X:155207372-155207394 TGCTCAGTCTAGTCACCACATGG + Intronic