ID: 940009522

View in Genome Browser
Species Human (GRCh38)
Location 2:149038949-149038971
Sequence CCGCGGGGCCGCGGGGCCGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 828
Summary {0: 1, 1: 3, 2: 13, 3: 158, 4: 653}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940009508_940009522 15 Left 940009508 2:149038911-149038933 CCTTCTGGGCGCGCTGGGGCAGC 0: 1
1: 0
2: 0
3: 15
4: 181
Right 940009522 2:149038949-149038971 CCGCGGGGCCGCGGGGCCGCGGG 0: 1
1: 3
2: 13
3: 158
4: 653
940009506_940009522 17 Left 940009506 2:149038909-149038931 CCCCTTCTGGGCGCGCTGGGGCA 0: 1
1: 0
2: 0
3: 11
4: 134
Right 940009522 2:149038949-149038971 CCGCGGGGCCGCGGGGCCGCGGG 0: 1
1: 3
2: 13
3: 158
4: 653
940009507_940009522 16 Left 940009507 2:149038910-149038932 CCCTTCTGGGCGCGCTGGGGCAG 0: 1
1: 0
2: 1
3: 10
4: 232
Right 940009522 2:149038949-149038971 CCGCGGGGCCGCGGGGCCGCGGG 0: 1
1: 3
2: 13
3: 158
4: 653
940009514_940009522 -7 Left 940009514 2:149038933-149038955 CCAGGAGCTCGCGGGGCCGCGGG 0: 1
1: 0
2: 0
3: 60
4: 292
Right 940009522 2:149038949-149038971 CCGCGGGGCCGCGGGGCCGCGGG 0: 1
1: 3
2: 13
3: 158
4: 653

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940009522 Original CRISPR CCGCGGGGCCGCGGGGCCGC GGG Intronic
900082660 1:870044-870066 CCGTGGAGCCGCGGCCCCGCTGG - Intergenic
900117491 1:1034780-1034802 CGGCGGGTCCGCGGGGCTCCCGG + Intronic
900240707 1:1616034-1616056 GCTCGGGGGCGCGGGACCGCCGG - Intronic
900255069 1:1693575-1693597 CCGGGGGTCCTCGGGGCCGCAGG - Intronic
900263812 1:1746841-1746863 CCGGGGGTCCTCGGGGCCGCAGG - Intergenic
900389351 1:2427308-2427330 TCGTGGGGGCCCGGGGCCGCAGG + Intronic
900460495 1:2800269-2800291 GCGCGGGGAGGTGGGGCCGCTGG + Intronic
900513199 1:3069864-3069886 CCGCGGAGCCGGGTGGGCGCCGG - Intronic
900632273 1:3643604-3643626 CCGGGGCTCAGCGGGGCCGCTGG - Intronic
900632291 1:3643655-3643677 CCGGGGCTCAGCGGGGCCGCTGG - Intronic
900632309 1:3643706-3643728 CCGGGGCTCAGCGGGGCCGCTGG - Intronic
900632327 1:3643757-3643779 CCGGGGCTCAGCGGGGCCGCTGG - Intronic
900632345 1:3643808-3643830 CCGGGGCTCAGCGGGGCCGCTGG - Intronic
900632363 1:3643859-3643881 CCGGGGCTCAGCGGGGCCGCTGG - Intronic
900632381 1:3643910-3643932 CCGGGGCTCAGCGGGGCCGCTGG - Intronic
900632399 1:3643961-3643983 CCGGGGCTCAGCGGGGCCGCTGG - Intronic
900632417 1:3644012-3644034 CCGGGGCTCAGCGGGGCCGCTGG - Intronic
900632435 1:3644063-3644085 CCGGGGCTCAGCGGGGCCGCTGG - Intronic
900632453 1:3644114-3644136 CCGGGGCTCAGCGGGGCCGCTGG - Intronic
900632471 1:3644165-3644187 CCGGGGCTCAGCGGGGCCGCTGG - Intronic
900632489 1:3644216-3644238 CCGGGGCTCAGCGGGGCCGCTGG - Intronic
900632507 1:3644267-3644289 CCGGGGCTCAGCGGGGCCGCTGG - Intronic
900632525 1:3644318-3644340 CCGGGGCTCAGCGGGGCCGCTGG - Intronic
901002573 1:6155880-6155902 CTGCGGGGCTGCGGGGCTGCAGG - Intronic
901109558 1:6784702-6784724 CCGTGGGGACGCGGCGCCGAGGG + Intergenic
901332768 1:8423730-8423752 GCGCGGGGCCCGGGGGGCGCGGG + Intronic
901373070 1:8817252-8817274 CTGCGGGGCCGCGGGGCGCAGGG + Exonic
901643489 1:10704809-10704831 CCGCGGGGCCACCGGGCCTCGGG - Intronic
902336776 1:15758716-15758738 GCGCGGGGCGGCGGGGCGGAGGG + Intronic
902371983 1:16013110-16013132 CCAAGCGGCCGCTGGGCCGCTGG - Intergenic
903044178 1:20553359-20553381 CCGGGGGTTCGGGGGGCCGCAGG + Exonic
903184764 1:21622665-21622687 GCGCGGTGTCCCGGGGCCGCGGG - Intronic
903349744 1:22710695-22710717 TCGCGGCGGCGCGCGGCCGCCGG + Intergenic
903420918 1:23217408-23217430 CCCCGGGGCGGCGGGGCGGGCGG - Intergenic
903468483 1:23568489-23568511 CGCCGGGGCCGCAGGGACGCTGG - Intergenic
903736077 1:25530594-25530616 CTGCGGGGCTGCGGGGCTGCGGG + Intergenic
903788242 1:25875402-25875424 CGGCGGGGCTGCGGGGCTGCGGG - Intergenic
903813188 1:26046121-26046143 CCGCTGCGCCCCGCGGCCGCCGG + Exonic
903950719 1:26994442-26994464 CTGCGGGGAGGCGGGGCCGCGGG - Exonic
904034634 1:27552008-27552030 CCGGGGGGTGGGGGGGCCGCCGG + Exonic
905202153 1:36322603-36322625 GAGCCGGGCCCCGGGGCCGCGGG + Exonic
905617200 1:39409215-39409237 CGGCGGGGCCGCGGGGCCAGCGG + Intronic
906214383 1:44030524-44030546 GGGCGGGGCCGGGCGGCCGCAGG - Intronic
906525083 1:46489206-46489228 CCTCTGGGCCGGGAGGCCGCGGG - Intergenic
906636945 1:47416274-47416296 CCGCGCGGCTCCGGGACCGCAGG - Exonic
907278006 1:53327613-53327635 CCGCGGGGGCGGGGGGCCGAGGG + Intronic
907364300 1:53946366-53946388 CCGTGGGACCGCGGGACCGGCGG - Exonic
907429932 1:54405905-54405927 CCGCGCCGCCGCCGGGCTGCGGG - Intronic
907682663 1:56578836-56578858 ACGAGGGGCCGAGGGGCCGAGGG + Intronic
907682666 1:56578844-56578866 CCGAGGGGCCGAGGGACAGCGGG + Intronic
908534866 1:65067540-65067562 GCGCGGGGCCGAGCGCCCGCGGG - Intergenic
909548040 1:76868684-76868706 CCGCGGTCCCGCGGGGACCCCGG - Exonic
912381366 1:109249770-109249792 CAGGGGCGCCGCGGGGCCCCCGG + Intergenic
912408866 1:109466423-109466445 CCGCGGGGCGGGGGGGACTCCGG - Intergenic
912492697 1:110070701-110070723 GCGCGGGGGCGCGGAGCCCCCGG + Intronic
913449058 1:118979975-118979997 CCGAGGGGCCGAGGGGCCGAGGG + Intronic
914197340 1:145454431-145454453 GCCCGGGGCGGCGGGGCCGGCGG - Intergenic
914702729 1:150149654-150149676 CCACTGGGCCCCGGGGCGGCCGG + Intronic
915244089 1:154544035-154544057 CCGTGGGGAGGCGGGGCTGCTGG + Exonic
915519859 1:156435804-156435826 CCGCAGAGCCGCGGGTGCGCGGG + Intergenic
915932716 1:160070056-160070078 CCGCGGGGCAGCGGGACAGATGG + Exonic
915977569 1:160400874-160400896 GTGCCGGGCCGCGGGGGCGCGGG + Intronic
916052387 1:161045545-161045567 CCGCGGAGCAGCTGGGGCGCGGG - Intronic
917433994 1:175000288-175000310 GCGCGGGACCGGGTGGCCGCAGG - Intronic
917797525 1:178542735-178542757 CGGCGGGGGCGCGGGGGCGTCGG - Intronic
917962346 1:180154981-180155003 CCGCGGGGCCGCGTTAGCGCCGG - Exonic
918265656 1:182839482-182839504 ATGCGGGGCGGCGGGGTCGCGGG + Intronic
919049806 1:192499347-192499369 ATGCGGGGCCGCGGGGCCCGCGG + Intergenic
919892037 1:201982689-201982711 CCGCCGGGCCGCGCCGCTGCCGG - Exonic
920002320 1:202808236-202808258 CCTCGGGGGCCCGGGCCCGCTGG - Exonic
921046126 1:211479173-211479195 CCAGGCTGCCGCGGGGCCGCAGG + Exonic
921383838 1:214551019-214551041 GCGCGGGGTGGCCGGGCCGCAGG - Intronic
922618285 1:226976172-226976194 CTGCGGGGCTGCGGGACTGCGGG + Intronic
922618309 1:226976268-226976290 CTGCGGGGCTGCAGGGCTGCGGG + Intronic
922618324 1:226976324-226976346 CTGCGGGGCTGCGGGACTGCGGG + Intronic
922618349 1:226976420-226976442 CTTCGGGGCTGCGGGGCTGCGGG + Intronic
922730700 1:227947673-227947695 CCGGGGCGCGGCGGGGCCGCCGG - Intronic
922739386 1:228006918-228006940 CCGGGGCGGCGCGGGGCGGCGGG - Intergenic
923490417 1:234478940-234478962 GCGCGCGGCAGCGGGGGCGCAGG - Exonic
923506459 1:234609773-234609795 GCGCGGCGCGGCGGGGCGGCGGG + Intergenic
923630804 1:235648792-235648814 CCGCGGGGCCGGGGAGACGGTGG + Intronic
923631208 1:235650202-235650224 CCGCGTGGCCGGGGGACCACTGG + Intronic
924778407 1:247126833-247126855 CCGAGGAGCCGCGGGGCTGCGGG - Intronic
924783251 1:247171587-247171609 CCGAGGAGCCGCGGGGCTGCGGG + Intronic
1062774734 10:135575-135597 CGGCGGGGCGGCGGGGCGGGCGG + Intronic
1063298055 10:4826286-4826308 GTGCGGGGCGGCGGGGCGGCGGG + Exonic
1063298058 10:4826294-4826316 CGGCGGGGCGGCGGGGCGGCCGG + Exonic
1063636442 10:7787625-7787647 CCGCTGGGCCCGGGGGCTGCGGG + Intronic
1064028732 10:11869780-11869802 CTGCGGGGCCCCCGGGCGGCAGG - Exonic
1066994750 10:42553207-42553229 CCGCGGCGCAGCGGGGCCACAGG - Intergenic
1067436974 10:46285018-46285040 TCGCGGGGCCGCCAGGCCGCCGG - Intergenic
1067572929 10:47384666-47384688 CCGCGGGGCCTCGGCGATGCGGG + Intergenic
1067669635 10:48307003-48307025 CCGAGGGGGCGTGGGGCTGCGGG + Intronic
1069761834 10:70816321-70816343 GCGCGGGGCCGCGGTGGGGCGGG + Intronic
1069774629 10:70919260-70919282 CCGGGGGGCAGAGGGGCAGCAGG + Intergenic
1069942429 10:71964653-71964675 CCGCGGAGGGTCGGGGCCGCCGG + Exonic
1069992958 10:72326053-72326075 CCCCGGGGCGGCAGGGCCGGCGG - Intergenic
1070140205 10:73733034-73733056 ACCCGGGGCCGTTGGGCCGCCGG - Intergenic
1072059748 10:91798484-91798506 CCGCGGGGCAGCCGGGGGGCAGG + Exonic
1072770731 10:98135051-98135073 CCTCGGGGCTGCGGGGCCGTGGG + Intronic
1072770732 10:98135059-98135081 CTGCGGGGCCGTGGGCCCCCAGG + Intronic
1072783987 10:98268234-98268256 GCTCGGGGCTGGGGGGCCGCGGG - Exonic
1073249840 10:102114665-102114687 CCTGGGGGGCGGGGGGCCGCGGG + Intronic
1073325846 10:102643732-102643754 CGGCGGGGGCGCCGGGCCTCGGG + Intergenic
1074829992 10:117241333-117241355 CCCCGGGGCAGCCGGGGCGCAGG + Intronic
1075119238 10:119651927-119651949 CCGGGGGGACGCGAGGCGGCGGG + Intronic
1075430328 10:122374882-122374904 CTGCGGGGCTGCCGGGCTGCTGG + Intronic
1075728611 10:124623300-124623322 TGGCGGGACCGCGGGGCCCCTGG - Exonic
1075766767 10:124899406-124899428 CCACGGGGCTGCCTGGCCGCAGG - Intergenic
1075999841 10:126905726-126905748 CGCCGGGGGCGCGGGGCGGCCGG - Intronic
1076096502 10:127737831-127737853 CCGCCGGGCCGCGGGCACTCCGG + Intronic
1076554172 10:131311409-131311431 CCGGGGAGCAGCGGGGCCGCGGG + Exonic
1076849948 10:133087883-133087905 CAGCGGGGACCCGGGGCCGGAGG - Exonic
1076884490 10:133255538-133255560 CGGCGGGACCGCGGGGCAGAGGG - Intergenic
1077014701 11:394382-394404 CCGGGGCGCCGAGGGGCCGGAGG + Exonic
1077047758 11:553862-553884 CCTCGGGGCTGCAGGGCCACGGG + Intronic
1077049434 11:560243-560265 CCGCGAGGCTGCGGGGCCCTGGG + Intronic
1077065538 11:639563-639585 GCGCGGGGGCGCCGGGGCGCGGG - Intronic
1077102270 11:827541-827563 CCGCGCGGCAGCAGGGCCCCAGG - Intronic
1077107869 11:849761-849783 CCGCGCGGGGGCGGAGCCGCCGG + Intronic
1077144218 11:1037502-1037524 CTGCGGGGCTGTGGGGTCGCCGG + Intergenic
1077250064 11:1557012-1557034 CGGCGGGGGGCCGGGGCCGCCGG + Exonic
1077326680 11:1967013-1967035 CTGGGGGGCTGCAGGGCCGCCGG + Intronic
1077360792 11:2139431-2139453 CCGCGCGGGCCCTGGGCCGCGGG - Intronic
1077404566 11:2377398-2377420 GCGCGGGGGCGCGGGGGCGCGGG - Exonic
1077480614 11:2812754-2812776 CCCCGGGGGCGTGGGGCCTCGGG - Intronic
1077495757 11:2885900-2885922 CCGCGGCGGGGCGGGGCAGCGGG - Intergenic
1077544943 11:3165177-3165199 CCGGGGGGCGGCAGGGCGGCGGG - Intronic
1078090718 11:8263029-8263051 CCGCGGGGCCGCGCGGAGGCTGG - Intronic
1078190781 11:9091399-9091421 GGGCCGTGCCGCGGGGCCGCAGG - Exonic
1078514305 11:12009223-12009245 CCGGGAGGCCGCCGGGCTGCGGG + Intronic
1079035149 11:17014280-17014302 ACCCGGGGACGCGGGGACGCGGG - Intronic
1079592167 11:22193591-22193613 CCCCGGGGCCTCTGCGCCGCGGG - Intronic
1080384825 11:31805140-31805162 GCGCGGGGTCGCGGGCCGGCCGG - Intronic
1081528329 11:43942283-43942305 CGGGTTGGCCGCGGGGCCGCAGG - Exonic
1081574165 11:44309147-44309169 CTGCGGGGCTGCGGGACAGCAGG - Intronic
1081574166 11:44309155-44309177 CTGCGGGGCTGCGGGGCTGCGGG - Intronic
1081574169 11:44309163-44309185 CTGCGAGGCTGCGGGGCTGCGGG - Intronic
1081574172 11:44309171-44309193 CTGCGGGGCTGCGAGGCTGCGGG - Intronic
1081574176 11:44309187-44309209 CTGCGGGGCTGCGGGGCTGCGGG - Intronic
1081574179 11:44309195-44309217 CTGCGGGGCTGCGGGGCTGCGGG - Intronic
1081574182 11:44309203-44309225 CTGCGGGGCTGCGGGGCTGCGGG - Intronic
1081574185 11:44309211-44309233 GCGCTGGGCTGCGGGGCTGCGGG - Intronic
1081807147 11:45896841-45896863 CCGGGGGGCTGCGGGGCCCCAGG - Intronic
1081872955 11:46391586-46391608 CCGCGGCGGCGCGGGGGCGGGGG - Intergenic
1081872993 11:46391677-46391699 CCGCGGGCCGGCGGGGCGGGCGG + Intergenic
1081915294 11:46726643-46726665 CCGAGGGGATGCGGGGCTGCGGG + Intronic
1081969240 11:47186524-47186546 CGGCGGGGCAGCGGGGCTGCAGG + Intergenic
1083323925 11:61863791-61863813 GCGCGGGGCTGCGGGGAGGCGGG + Intronic
1083436326 11:62646160-62646182 CCGAGGGGCCGCGGGGCCGCAGG + Intronic
1083457135 11:62786814-62786836 CCGGGCGGCCGCGGAGCCGTGGG - Exonic
1083572656 11:63768636-63768658 GAGCGGGGCCCCGGGGCGGCGGG + Exonic
1083572665 11:63768651-63768673 GCGGCGGGGCGCGGGGCCGCGGG + Exonic
1083572668 11:63768659-63768681 GCGCGGGGCCGCGGGGCCGGCGG + Exonic
1083644914 11:64166399-64166421 CCGCGGGGCCGAGCGGCAGAGGG - Intergenic
1083888698 11:65585210-65585232 TCACGGGGCCGAGGGGCCCCAGG + Exonic
1083895214 11:65616302-65616324 CGGCGGGGCCATGGGGTCGCAGG + Exonic
1084046049 11:66568309-66568331 CGGCCGGGCTGCGGGGACGCGGG - Exonic
1084129140 11:67119621-67119643 CCGGGGGGCCGGGGCGGCGCGGG + Intronic
1084207943 11:67606828-67606850 CCCCGAGGAGGCGGGGCCGCTGG + Intergenic
1084310447 11:68313215-68313237 CGGGGCGGCCGCGCGGCCGCTGG - Intronic
1084968148 11:72755142-72755164 CGGCGGGGCGGCGGGCCCACAGG - Exonic
1085485609 11:76860784-76860806 CACCGGCGCCGCTGGGCCGCGGG - Intergenic
1085640282 11:78188914-78188936 CGGCGCGGCCCCGGGGCTGCGGG - Exonic
1087138121 11:94740521-94740543 CCTCGGGCCCCCGGGACCGCGGG + Intronic
1087761745 11:102110376-102110398 AGGCGGGGCCGCGGCGGCGCGGG + Intergenic
1088223392 11:107591859-107591881 CAGCCGGGCTGCGGGGCCGCCGG + Intronic
1089347063 11:117797289-117797311 CCGGGGTGCCGCGGGGGGGCGGG - Intronic
1089622448 11:119729496-119729518 CCGCCGCGCCTCGGCGCCGCCGG - Intergenic
1089729439 11:120511468-120511490 GCGCGGGTCCGCGCGGCCGGGGG - Intergenic
1090699148 11:129279151-129279173 CGGCGGCGCGGCGGGGCCGCGGG - Intronic
1090699256 11:129279452-129279474 CCCCGGGGACGCGGGTCCTCGGG + Intergenic
1202809661 11_KI270721v1_random:22193-22215 CTGGGGGGCTGCAGGGCCGCCGG + Intergenic
1092108889 12:5945233-5945255 GCGCGCGGCCGCGGGCCGGCGGG - Exonic
1092246647 12:6867752-6867774 CCTCGGGGCCTCGGGGCCTCGGG - Intronic
1092258088 12:6937769-6937791 CGCCGGGGCCGCGGCGCTGCGGG + Intronic
1092743250 12:11649917-11649939 GCGCGGGGCGGCGGGGGCGTGGG - Exonic
1093972339 12:25386378-25386400 CTGCGGGCACGCGGGGCCGCGGG + Intergenic
1095261718 12:40105830-40105852 CCGGGGGGACGCGGCTCCGCGGG + Exonic
1095476182 12:42589510-42589532 CTGCGGGGCTGCTGGGCTGCGGG + Exonic
1095476185 12:42589518-42589540 CTGCTGGGCTGCGGGGCTGCGGG + Exonic
1096435874 12:51591009-51591031 CCGCGGGGGCGCGGGCGGGCGGG + Intronic
1096459467 12:51814332-51814354 CCGCGGCGCGCCGGGGGCGCGGG + Intergenic
1096459502 12:51814473-51814495 CCGGGCGGCCGCTGCGCCGCAGG + Intergenic
1096493016 12:52023308-52023330 CCCCGGGGCCGCGAGGCTGTGGG + Intronic
1096647683 12:53047447-53047469 GCCAGGGGGCGCGGGGCCGCCGG + Intronic
1096694606 12:53340561-53340583 CAGCGGGGCCGCAGAGCAGCGGG - Intronic
1096714456 12:53482824-53482846 TCCCGGGGCCGGGGGGCCACAGG - Exonic
1096738876 12:53677205-53677227 GCTCGGGGCCGGGGCGCCGCGGG - Intronic
1097123225 12:56752356-56752378 CTGCGCAGTCGCGGGGCCGCCGG - Intronic
1101466907 12:104958325-104958347 CCGCGCGGGGGCGGGGCGGCGGG - Intronic
1101606032 12:106248123-106248145 CGGCGGGGAGGAGGGGCCGCCGG - Intronic
1102884073 12:116508526-116508548 CGGCGGCGCGGCGGGCCCGCTGG - Intergenic
1102973567 12:117190190-117190212 CAGCCGGGGCGCGGGGCCGCTGG + Intronic
1103534685 12:121626568-121626590 ACGCAGGCCCGCGGCGCCGCTGG - Exonic
1103570117 12:121839425-121839447 CCGCGGGACCGAGGAGCTGCGGG - Intergenic
1103691030 12:122774557-122774579 GCGCGGGGCCCCGGGGCTCCGGG + Exonic
1103764430 12:123271001-123271023 CCCTGAGGTCGCGGGGCCGCCGG - Intronic
1103764441 12:123271027-123271049 CTGCGGGGCTGCCGGGCTGCCGG - Intronic
1103764443 12:123271035-123271057 CTGCGGGGCTGCGGGGCTGCCGG - Intronic
1103764445 12:123271043-123271065 CTGCGGGGCTGCGGGGCTGCGGG - Intronic
1103779398 12:123389108-123389130 CCGGGGCGCCGCGGCGGCGCTGG + Intronic
1104980175 12:132570135-132570157 CCGCGGGGCTGCGGGGGTGGCGG - Exonic
1105031495 12:132887432-132887454 CTGCGGGGCTGCGTGGGCGCGGG - Intronic
1105049685 12:133037499-133037521 TCGCGAGGCCGCGGGCGCGCGGG + Intronic
1105389200 13:19959170-19959192 CGGCGGGGCGGCGGGACGGCGGG + Intronic
1105512197 13:21060831-21060853 CCGTGGGACCGCTGCGCCGCCGG + Intronic
1106087640 13:26557746-26557768 CCGGGCGGCCGCGGCGCGGCGGG + Exonic
1110318513 13:74135309-74135331 CCGCGGGGCCCGGGGGCGGCGGG + Intergenic
1110436461 13:75482095-75482117 CCGAGGGTCCCCGCGGCCGCCGG + Exonic
1112012026 13:95300997-95301019 ACGCGGGGACGCGGGGCCAGTGG - Intronic
1112091897 13:96091108-96091130 TCGGGGGGCCGCGGCGCCGGAGG + Exonic
1112504930 13:99969855-99969877 CCGAGGGGCTGCGGGCGCGCTGG + Intronic
1112507507 13:99983811-99983833 CCGCGGGGCCGCGCTGCCTGGGG - Intronic
1113082873 13:106535728-106535750 GCGCGCGGCCGCGGAGCCGCGGG - Intergenic
1113201068 13:107867601-107867623 GCGGGCGGCGGCGGGGCCGCGGG + Intergenic
1113201072 13:107867609-107867631 CGGCGGGGCCGCGGGGCCCGGGG + Intergenic
1113653720 13:112055766-112055788 ACGCGGGGCCGCCTGGCCGAGGG + Intergenic
1114483249 14:23048048-23048070 CCCCGGCCCCGCGGAGCCGCTGG - Exonic
1114483251 14:23048049-23048071 CAGCGGCTCCGCGGGGCCGGGGG + Exonic
1115545624 14:34462564-34462586 CCGCTGGGCTGCGGGGGCCCCGG - Intronic
1115651378 14:35404669-35404691 CTGCGGGTGCGCTGGGCCGCGGG + Exonic
1115850760 14:37588231-37588253 ACGCGGGCCGCCGGGGCCGCAGG + Intergenic
1115852662 14:37599856-37599878 GCGCGCGGCCGCGGGGACCCAGG - Intronic
1117119708 14:52553622-52553644 GGGCGGGTGCGCGGGGCCGCCGG + Intronic
1117547816 14:56807968-56807990 CTGCGGGGCTGCGGGGCTGCCGG - Intronic
1117547818 14:56807976-56807998 CTGCGGGGCTGCGGGGCTGCGGG - Intronic
1117547821 14:56807984-56808006 CTGCGGGGCTGCGGGGCTGCGGG - Intronic
1117547824 14:56807992-56808014 CTGCGGGGCTGCGGGGCTGCGGG - Intronic
1117964064 14:61189140-61189162 TCGCGGGGGCGCTGGGGCGCTGG - Intronic
1118285259 14:64465367-64465389 GCGCGGGGCGGCGCGGGCGCCGG - Intronic
1119492804 14:75051238-75051260 CCGCCCGGCCGCCAGGCCGCCGG + Intronic
1119492809 14:75051246-75051268 CCGCCAGGCCGCCGGGCCTCCGG + Intronic
1119701918 14:76761523-76761545 CAGCGGGGCCCAGGGGCGGCGGG + Intergenic
1120704786 14:87735034-87735056 ACTCGGGGCGGCGGGGCGGCCGG - Intergenic
1121546933 14:94769697-94769719 CTGCGGGGCCGTGCCGCCGCTGG - Exonic
1121690839 14:95876366-95876388 CAGCGGCGCCGCGGGGCGGGGGG + Intergenic
1122581983 14:102777126-102777148 ACGCGGGGACGCGCGGCGGCGGG + Intergenic
1122582196 14:102777758-102777780 CGGCGGGGCCCGGGGGCCTCGGG + Intronic
1122645159 14:103189233-103189255 CCGCGGGGCTGCGGGGTCGAGGG + Intergenic
1122736589 14:103847210-103847232 CCGCGGGGGCTGGGAGCCGCGGG + Intronic
1122904477 14:104795539-104795561 CCGCGGGGATGCGGAGCGGCGGG - Intronic
1122975027 14:105167551-105167573 CGCCGGGGCCCCGGGGCCACCGG - Intronic
1122975463 14:105168949-105168971 CGGCGGGGGCACGGGGCCTCGGG + Intergenic
1125503204 15:40252321-40252343 CCACTGGGCCGTGGAGCCGCAGG + Exonic
1125524887 15:40368520-40368542 GCGCTGGGCCTCAGGGCCGCTGG - Exonic
1125589138 15:40843917-40843939 CACCGGGGCTGCGGGGCCGCGGG + Intergenic
1127103192 15:55588064-55588086 CCTCGGGGCGGCGGGGCGGCGGG + Intronic
1127789886 15:62390435-62390457 CCGCGGCGCCGCGCGGCACCGGG - Intergenic
1128109578 15:65067998-65068020 CCGCGGGGAGGAGGGGCCGGTGG + Exonic
1128111194 15:65077268-65077290 CCGCGTAGCTGCTGGGCCGCAGG - Exonic
1128161034 15:65422951-65422973 CCGGGGAGGCGCGGCGCCGCGGG + Exonic
1128455633 15:67829871-67829893 CCGCGAGCGCGCGTGGCCGCCGG - Intronic
1128547750 15:68579231-68579253 CCGCGGCGGAGCGGGGGCGCGGG - Exonic
1128841430 15:70854092-70854114 TCGCGGGACTGCGGCGCCGCCGG + Exonic
1129351143 15:74956631-74956653 CCCCGGGGCTGCATGGCCGCCGG + Exonic
1129503246 15:76059912-76059934 CGGCGGGGCCGCGAGGGGGCGGG + Exonic
1129817237 15:78565694-78565716 CCGCGGTCCCGCGCGGGCGCGGG + Exonic
1130076511 15:80695031-80695053 CCGCGCGGCGGCGCCGCCGCTGG - Intronic
1130411726 15:83653838-83653860 GCGCGGGGCCGCGGCGACGGCGG - Intergenic
1132111594 15:99105708-99105730 CGGCGGCGCGGCGGGGCCGGTGG - Exonic
1132480578 16:164715-164737 GGGCGGGGCCGCGGGGCGGGCGG + Intronic
1132527694 16:425803-425825 CCGCCGCGCCGCCGGGCCGAGGG + Exonic
1132548370 16:543973-543995 CCGCATGGCCGCATGGCCGCAGG - Intronic
1132581000 16:684560-684582 CCGTAGGCCCGCGGGGCAGCTGG - Intronic
1132744997 16:1432823-1432845 CAGCGGGGTCTCGGGGCTGCCGG - Intergenic
1132778519 16:1610524-1610546 CCGCGGGGACTCGGCGGCGCCGG + Intronic
1132815909 16:1826522-1826544 CGGAGCGGGCGCGGGGCCGCGGG - Intronic
1132849852 16:2020099-2020121 GCGCGCGGCCGCCGGGCCCCTGG + Exonic
1133156485 16:3880219-3880241 CGGGGGGGCGGCCGGGCCGCCGG - Exonic
1133271857 16:4614367-4614389 CCGCGGGGCCGCCCGGCCCTCGG + Intronic
1133271886 16:4614434-4614456 CCGCGGGGCCGCGAGTCCCCCGG - Intronic
1133784440 16:8963615-8963637 GGCCGGGGCTGCGGGGCCGCGGG + Intronic
1133784443 16:8963623-8963645 CTGCGGGGCCGCGGGCCGGCCGG + Intronic
1133784579 16:8964080-8964102 CCGCGGGGCTGCGGCGCAGGCGG - Intronic
1133802134 16:9092391-9092413 CGGCAGGGCCGCGGAGCCACCGG - Intronic
1134121342 16:11586854-11586876 GCGCGGGGACGCCGGGGCGCGGG - Intronic
1135115329 16:19718589-19718611 CCGCCGGGCAGCGGCTCCGCGGG + Intronic
1135135773 16:19884732-19884754 CGTCGGCGCTGCGGGGCCGCGGG - Exonic
1135404760 16:22190258-22190280 CCGTGGAGCCGCGGGGCCGCCGG - Exonic
1135607364 16:23836117-23836139 CCCCGGGGCCGCGGGACCGCGGG - Exonic
1136242104 16:28951022-28951044 CTGTGGGGAAGCGGGGCCGCTGG + Exonic
1136285321 16:29237216-29237238 CGGCGGGGAGGCGAGGCCGCGGG + Intergenic
1136285330 16:29237241-29237263 CGGCGGGGAGGCGAGGCCGCGGG + Intergenic
1136377992 16:29876719-29876741 GGGCGGGGCCGAGGGGACGCGGG + Intronic
1136417891 16:30114513-30114535 CCACGGGGCCTCGGGACCTCAGG - Exonic
1136485584 16:30570015-30570037 CCGGGGGGCGGCGGGGCCGGAGG - Exonic
1136590400 16:31214855-31214877 CCGCGTGGCCGGGGAGCCGGCGG + Exonic
1136779011 16:32885618-32885640 CCGGGGGGCGGCCGGGCCGGGGG + Intergenic
1136891607 16:33975900-33975922 CCGGGGGGCGGCCGGGCCGGGGG - Intergenic
1137454732 16:48609742-48609764 CCGCGGGCGCGCGGGGGCGGCGG + Intronic
1137731434 16:50693467-50693489 CTGCGGGGCTGCGGGGCTGCGGG + Intergenic
1137731437 16:50693475-50693497 CTGCGGGGCTGCGGGGCTGCGGG + Intergenic
1137731440 16:50693483-50693505 CTGCGGGGCTGCGGGGCCACGGG + Intergenic
1137988468 16:53130470-53130492 CGGCGGGGCCGCGGGGCGGGCGG + Intronic
1138495123 16:57404164-57404186 TCGCGGGGCCTCGTGGCTGCTGG + Intergenic
1138619177 16:58197956-58197978 CGGCGGGGCGGCGGGGCGGGCGG + Intergenic
1139451353 16:67029853-67029875 GCGCGGGGCCGCGGCGGCCCAGG + Intronic
1139484693 16:67248954-67248976 CGGCGGCGACGCGGGGCCGGCGG + Exonic
1139954205 16:70685652-70685674 CCCCGGGGACGCGTGGCGGCGGG - Intronic
1141054729 16:80804488-80804510 CCGCCGGGTCGCCGGGTCGCGGG - Intergenic
1141697625 16:85627666-85627688 CCGGGGGGCCGGGGGGCCGGGGG - Intronic
1141736833 16:85859718-85859740 CGGCAGGGCCGCGGGGCCGCTGG + Intergenic
1141972351 16:87492468-87492490 CCGGGGGGGCCCGGGGCGGCCGG + Intergenic
1142136344 16:88453553-88453575 CGGGGGCGCGGCGGGGCCGCGGG - Exonic
1142197126 16:88744132-88744154 AGGCGGGGGCGCGGGGCCCCTGG - Intronic
1203081422 16_KI270728v1_random:1147707-1147729 CCGGGGGGCGGCCGGGCCGGGGG + Intergenic
1142513154 17:410519-410541 GGGCGGCGCCGCGGGCCCGCGGG + Exonic
1142709570 17:1715864-1715886 CCGAGGGGCCGGAGGGCCGGGGG - Intergenic
1142799635 17:2337288-2337310 CCGCGGGGCCGCGGGCTCCAGGG + Exonic
1142810381 17:2393183-2393205 CCGCGGAGACGCGGAGCCGTAGG - Intronic
1142812289 17:2401003-2401025 CCCGGGGGCCGCGGGGCGGGAGG - Exonic
1142848129 17:2691926-2691948 GGGCGGGGCCGCGGGGGCACGGG - Intronic
1143063354 17:4222209-4222231 CCGCGGGGCGGCGGGGGCGGCGG - Intronic
1143134452 17:4703828-4703850 CCACAGGGCCGCGGGCACGCGGG + Intronic
1143625790 17:8109644-8109666 CCGCCGGGCCACGGGTCCACAGG - Intronic
1143635577 17:8162401-8162423 CTGCGGGGCCGGGAGGCTGCAGG - Intronic
1143635776 17:8163051-8163073 CCGCGGGGGCGGGGCGCTGCGGG + Intronic
1143784294 17:9245168-9245190 CCCAGGGCCAGCGGGGCCGCTGG + Intergenic
1143958866 17:10697710-10697732 GGGCGGTGCTGCGGGGCCGCGGG + Intronic
1145077509 17:19867855-19867877 GCGCGGGGCCGCGGCGGTGCGGG - Exonic
1145388405 17:22435585-22435607 CCCTGGGGCGGCGGGGCCGGTGG - Intergenic
1145863780 17:28227542-28227564 CCCCGGTGGAGCGGGGCCGCAGG - Intergenic
1146008434 17:29176886-29176908 CCGCGGGGCTGCGGCTGCGCCGG - Intronic
1146058692 17:29593535-29593557 GCCCGGGGCCGCGGGGCGGGGGG - Exonic
1146062057 17:29612824-29612846 CCGCGGGCGCGCGGGGCCACGGG + Intronic
1146322630 17:31858906-31858928 CCGCGGGGCCGCGGGGCTGCGGG - Intronic
1146322635 17:31858914-31858936 CGGCCAGGCCGCGGGGCCGCGGG - Intronic
1146382570 17:32341897-32341919 CGGCCGGGCCGCTGGGCCGGGGG + Intronic
1147218087 17:38912461-38912483 CCGCTGGGCCAGGGTGCCGCAGG + Intronic
1148183042 17:45620507-45620529 GCGGGGGGCCGCGGGGCCCGGGG + Intergenic
1148265811 17:46225184-46225206 GCGGGGGGCCGCGGGGCCCGGGG - Intronic
1148493476 17:48037833-48037855 CCGCGGGGCGGCGCGGAGGCGGG - Intronic
1149296414 17:55265707-55265729 GCGCGGGGCCGGGGCGCCGCGGG - Intronic
1149996634 17:61409315-61409337 CCGAGGGGTCGAGGGGCCGGCGG - Exonic
1149996638 17:61409323-61409345 CCGAGGGGCCGAGGGGTCGAGGG - Exonic
1149996642 17:61409331-61409353 CGGAGGGGCCGAGGGGCCGAGGG - Exonic
1150069782 17:62140594-62140616 CCGGGCGGCCGCAAGGCCGCAGG + Intergenic
1151478631 17:74357250-74357272 CCGCGGGGCCGTGGCGCGCCAGG + Exonic
1151673913 17:75588458-75588480 CCTCGGCTCGGCGGGGCCGCCGG + Intergenic
1151783787 17:76265440-76265462 ACGCGGGGCTGCGCGGGCGCGGG - Exonic
1151866422 17:76806241-76806263 CGGCGGGGCCGGGGGGCTGGCGG - Intergenic
1151866425 17:76806249-76806271 CGGCGGGGCGGCGGGGCCGGGGG - Intergenic
1152049088 17:77958776-77958798 CTGCGCGGCGGCGGGGCCGGCGG - Intergenic
1152049225 17:77959215-77959237 CCGCGGGGCTCCGGTGGCGCGGG - Intergenic
1152467827 17:80475849-80475871 CCGCGGGGCCTCGCAGGCGCGGG + Intronic
1152541916 17:80981141-80981163 CCGCGGGGGCGCGGGGGCGGGGG - Intergenic
1152575828 17:81140642-81140664 CCGTGGGGCCGGGGGACCGTGGG + Intronic
1152575832 17:81140650-81140672 CCGGGGGACCGTGGGGCCGTGGG + Intronic
1152575919 17:81140901-81140923 CCGTGGGGCCGTGGGGCCGTGGG + Intronic
1152575922 17:81140909-81140931 CCGTGGGGCCGTGGGACCGTGGG + Intronic
1152817855 17:82418719-82418741 TCGCGGGACCGCGGCGGCGCAGG + Exonic
1154070841 18:11149806-11149828 ACGCAGAGCCGCGGGGCTGCGGG - Intergenic
1154125598 18:11689620-11689642 CTGCGCGGCCTCGGAGCCGCCGG + Exonic
1154241510 18:12657778-12657800 CCGCGGGAGCCCGGGGCAGCCGG - Exonic
1154954680 18:21242402-21242424 CCGCGGGGACTCCGGGGCGCGGG + Intronic
1155054147 18:22170360-22170382 GTGCGGCGCCGCGGGGACGCCGG + Intronic
1156171835 18:34494355-34494377 CCCCGGGGACGGGGGGCGGCGGG + Intronic
1156350480 18:36297801-36297823 CCGCGGGGGCGCGGGCCCCGGGG - Intronic
1157473688 18:48008317-48008339 ACGCGGGGGCGCTGGGCCGGGGG + Intergenic
1157544521 18:48538817-48538839 CCGTGGGGTCGCTGGGCGGCGGG + Intergenic
1158718244 18:59899784-59899806 CCGCGGGTCGGCGCCGCCGCGGG + Intergenic
1159040707 18:63320459-63320481 CCGCGCGGCCGCGGCGCGGTGGG + Intergenic
1159770854 18:72543854-72543876 TGGCGGGGCTGCGGGGCCGAGGG - Intronic
1160025434 18:75211804-75211826 GCGCGGGGACGCGGGGCCCCGGG - Intronic
1160204751 18:76823027-76823049 TCCCGGGGCCGGAGGGCCGCGGG + Intronic
1160444381 18:78915618-78915640 ACGCGGAGCCATGGGGCCGCAGG + Intergenic
1160853549 19:1206054-1206076 CCGCGGGGCGGCGCGGCGGCGGG - Intronic
1160865753 19:1255231-1255253 CCGGGGGGCCGCGGGTCACCAGG + Intronic
1160948459 19:1654377-1654399 CGGCGGGGAGGCGGGGCCACAGG + Intergenic
1160951106 19:1667785-1667807 CCGTGGGGTCCCGGGGCAGCTGG + Intergenic
1160968604 19:1757571-1757593 CCGCGCGGCCCCGCGGCCGCGGG + Intronic
1160972382 19:1775441-1775463 GCGCGGGGCCGGGGCGCCTCAGG - Exonic
1161032446 19:2064447-2064469 CCGCTTGGCCGCGGGGCCACAGG - Intergenic
1161072389 19:2269416-2269438 GGGCAGAGCCGCGGGGCCGCCGG - Intronic
1161077695 19:2294358-2294380 CCGCAGGGCCGGGGGCCCTCTGG - Intronic
1161265154 19:3360339-3360361 GCGCGCGGCAGCGGGGCCGGGGG - Intronic
1161317874 19:3626709-3626731 CCGCGGGTCGCCGGGGCCGAAGG - Exonic
1161450643 19:4343633-4343655 GCGCGGGGCTGCAGGGGCGCGGG + Intronic
1161471267 19:4457717-4457739 GCGGGGGGCCGCGGGGGCGGGGG + Exonic
1161471272 19:4457725-4457747 CCGCGGGGGCGGGGGGGCACGGG + Exonic
1161743945 19:6043276-6043298 CAGCGGGGACGCAGGGCCTCAGG - Intronic
1161959515 19:7516126-7516148 TGGCGGGGCCGCTGGGCCGAGGG + Exonic
1162041844 19:7975516-7975538 CCGAGGGGCCGGGGAGCCCCAGG - Intronic
1162070497 19:8149519-8149541 CCCCGGGTCCCCGGCGCCGCAGG - Exonic
1162128245 19:8510882-8510904 CGCGGGGGCCGCGGGGGCGCCGG + Exonic
1162128250 19:8510890-8510912 CCGCGGGGGCGCCGGGGCGGTGG + Exonic
1162396527 19:10420670-10420692 CCGCGGGGCCCTGGGCTCGCTGG + Exonic
1162572147 19:11480039-11480061 CGGCGGGCCCGCGGGGCCTCCGG + Intronic
1162591981 19:11597821-11597843 ACGCGGGGCTGCGGGGCCGCAGG - Intronic
1162612627 19:11767878-11767900 CCGCGAGGCAGCGGGGCTGAGGG + Intronic
1162668692 19:12237194-12237216 CTGGGGAGACGCGGGGCCGCGGG + Intronic
1162778678 19:12995697-12995719 GCGCGGGGCCGCGGGCCGGGCGG + Exonic
1162895928 19:13764724-13764746 CAGCGGGGCGGCGGGGCGGCGGG + Intronic
1162895932 19:13764732-13764754 CGGCGGGGCGGCGGGGCGGCGGG + Intronic
1162895936 19:13764740-13764762 CGGCGGGGCGGCGGGGCGGCGGG + Intronic
1162895940 19:13764748-13764770 CGGCGGGGCGGCGGGGCGGCGGG + Intronic
1162895944 19:13764756-13764778 CGGCGGGGCGGCGGGGCGGCGGG + Intronic
1162895948 19:13764764-13764786 CGGCGGGGCGGCGGGGCGGCGGG + Intronic
1162895952 19:13764772-13764794 CGGCGGGGCGGCGGGGCGGCGGG + Intronic
1162895956 19:13764780-13764802 CGGCGGGGCGGCGGGGCGGCGGG + Intronic
1162895959 19:13764788-13764810 CGGCGGGGCGGCGGGGCGGCCGG + Intronic
1162975744 19:14206386-14206408 CGTCGGGGCCGCGGAGCTGCGGG - Intergenic
1163358314 19:16829458-16829480 CCCCCGGCCCGCGGGGCCGCCGG - Exonic
1163462729 19:17448558-17448580 CCCCGAGGGGGCGGGGCCGCAGG + Exonic
1163547295 19:17947972-17947994 GGGCGGGGCCGCGGGGCCGCCGG + Intergenic
1163551176 19:17967168-17967190 CCCGGGGGCGGCGGGGCCGGGGG - Intronic
1163551182 19:17967176-17967198 GCGCGGGGCCCGGGGGCGGCGGG - Intronic
1163725158 19:18919192-18919214 GCGCAGGGGCGCGGGGACGCTGG - Intronic
1163807083 19:19405931-19405953 CCGCGGGGCCGGGCGGCGGAGGG - Intronic
1163859266 19:19732691-19732713 CCGGGGAGACGCGGGGCTGCGGG + Intronic
1164648137 19:29873744-29873766 GCGCGGGGGCGCGGGGGCGCTGG - Intergenic
1164648140 19:29873752-29873774 CGGCGCGGGCGCGGGGGCGCGGG - Intergenic
1165058747 19:33194794-33194816 GCGCGCGGCCGCGGGGCTGGAGG + Exonic
1165213717 19:34254672-34254694 GCGGTGGGCAGCGGGGCCGCGGG + Intronic
1165309916 19:35023571-35023593 GCTCGGGGCTGCGGGGCTGCAGG + Intronic
1165408509 19:35644435-35644457 CCGGGGAGCGGCGGGGCCGAGGG - Intronic
1165431379 19:35775476-35775498 CCACGGGGGCGGGGGGCAGCGGG - Intronic
1165955424 19:39499249-39499271 CAGGGGGACCGCGGGGCCCCAGG - Exonic
1165957012 19:39507375-39507397 CCGCGGCCCCGCCGGGCCTCAGG + Exonic
1166326001 19:42051527-42051549 CCTAGGGGCTGCGGGGCAGCAGG - Intronic
1166836047 19:45668721-45668743 ACGTGGAGCCGCGGGGGCGCGGG + Intronic
1167080791 19:47274978-47275000 GCGAGGGCCCGCGGGGGCGCTGG + Exonic
1167268247 19:48493874-48493896 CGGCGGGGCCGCGGGGCCCCGGG - Exonic
1167268250 19:48493882-48493904 GGGCGCGGCGGCGGGGCCGCGGG - Exonic
1167286913 19:48603560-48603582 GGGCCGGGCCGGGGGGCCGCTGG + Exonic
1167376453 19:49114662-49114684 TCCCGGGGCCGCAGGGCCGCTGG + Intronic
1167668377 19:50836112-50836134 CCGCGTGGGGGCGGGGCTGCGGG - Intronic
1167738682 19:51311713-51311735 CCGGGGGGCGGCGGGGGCGGGGG - Intergenic
1168076292 19:53982443-53982465 GCCCGGGCCCCCGGGGCCGCCGG - Exonic
1168076314 19:53982519-53982541 CAGCGTGGCCGCGGGGCTGGCGG + Exonic
1168350967 19:55675289-55675311 CGGCGGGGCGGCGGAGCCGTCGG + Intronic
924985014 2:263455-263477 CGCCGGGGTCGCGGGGCCACAGG - Intronic
924987767 2:287748-287770 CCGGGGGGGCGCGGAGCCCCGGG - Exonic
926083391 2:10006486-10006508 CCGGGTGGACGCGGGCCCGCGGG - Intergenic
926089880 2:10043203-10043225 CGGCGGGGCGGCGGGGGCGGCGG - Intronic
926095618 2:10079611-10079633 AGGCGGGGCCGCGGGCCCGAGGG + Intronic
926154756 2:10447839-10447861 GCGCGGGGCCGCAGGGTCTCCGG + Intronic
926268326 2:11345121-11345143 GCGAGGGGCCGCAGGGCCGGGGG + Intronic
927422089 2:22944354-22944376 CCGCCAGGCCCCGGGGCAGCAGG + Intergenic
927652346 2:24920211-24920233 GCGCGTGGCCCCGGAGCCGCCGG - Intergenic
927709057 2:25314012-25314034 GCGCGGGGCTGGGGGGCTGCTGG + Exonic
927787307 2:25982588-25982610 GGGCGGGGCCGCGGGGCGGGAGG + Intronic
927964972 2:27262833-27262855 CCCCGGGACCGCGGTGGCGCCGG - Exonic
929061079 2:37925242-37925264 GCGGGGGGCCGAGCGGCCGCGGG + Intronic
929775737 2:44929574-44929596 CCGCTGAGCCGCGGGGCTCCCGG + Intergenic
929936331 2:46297057-46297079 GCGCAGGGCCGAGGGGCGGCCGG - Intronic
930089390 2:47520856-47520878 TCTCCAGGCCGCGGGGCCGCCGG - Exonic
931052274 2:58428401-58428423 CCGCGGCGGCTCGGGGCCGGCGG - Intergenic
931252854 2:60549608-60549630 CCGCGGGGCCTTGGGGCCCGGGG + Intronic
931321348 2:61177324-61177346 GCGCGGGGACGCGGGGACGCGGG - Intergenic
931321479 2:61177693-61177715 GTGCGGGGCCGCGGGGCCAGGGG + Exonic
931711001 2:64989166-64989188 ACCCGAGGCCGCGGGGGCGCGGG - Intronic
932722405 2:74147752-74147774 CGGAGGGACCGCGGGGCCGGCGG - Intronic
933666751 2:84970962-84970984 CCGCGGGGCCTCCGGGCGGCTGG + Intergenic
933895947 2:86809539-86809561 CAGAGGTGCCGAGGGGCCGCGGG + Intergenic
934754451 2:96816015-96816037 CCGGGAGGACGCGGGGCGGCGGG - Intergenic
934763821 2:96869646-96869668 CCCCGGGGCTGCGGGGCTGCAGG + Intronic
934933183 2:98445040-98445062 CGGCGGGACAGCGGGGCGGCTGG + Exonic
934933278 2:98445336-98445358 CCGAGCGGGCGCGTGGCCGCGGG + Intronic
935137727 2:100322096-100322118 CCGCGGGGCTGCGACGACGCGGG + Exonic
935622831 2:105144111-105144133 CTGCGCGGCCGCGGCGCCGCCGG - Intergenic
935622931 2:105144385-105144407 CCGCCGGGCCGCGGGGTCGGGGG + Intergenic
935645326 2:105329661-105329683 GAGCGGGGCGGCGGGGCCCCAGG - Exonic
936396953 2:112138531-112138553 CCGCGCGGCCGGGGGGCGGCTGG - Exonic
938338917 2:130522796-130522818 CCGCGCGGCCGCGCTGCTGCAGG + Exonic
938350921 2:130597954-130597976 CCGCGCGGCCGCGCTGCTGCAGG - Exonic
938392411 2:130916238-130916260 AGGCGGGGACGCGGGGGCGCTGG - Intronic
939969554 2:148644601-148644623 CCGCGGCGCTGCCGGCCCGCGGG - Intronic
940009518 2:149038941-149038963 TCGCGGGGCCGCGGGGCCGCGGG + Intronic
940009522 2:149038949-149038971 CCGCGGGGCCGCGGGGCCGCGGG + Intronic
940316870 2:152335743-152335765 GCGCGGGGACCCGGGGCCCCGGG + Intronic
941008365 2:160270320-160270342 CCGCGGGGCCCCCCGGGCGCAGG - Intronic
941112124 2:161427191-161427213 GCTCGAGGCCGCGGGGCCGCGGG + Intronic
941816297 2:169799133-169799155 CGGCGGAGCCGAGGGGGCGCGGG + Intronic
942890273 2:180980310-180980332 TCGCGGGGCCGCTGTGCCGCGGG - Intronic
942947294 2:181684175-181684197 CCGTGGGGCTCAGGGGCCGCAGG + Intergenic
943658676 2:190534835-190534857 CCGCCGTGCCCCGAGGCCGCGGG - Intergenic
944154047 2:196592852-196592874 CCGCAGGGCGCCGGGGCCGCGGG - Intronic
946843087 2:223837229-223837251 CCGCGGCGCCGCGTTGCCGCAGG + Intronic
947119536 2:226800175-226800197 CCGGGGGGAGGCGGGGGCGCCGG + Intergenic
947765250 2:232633666-232633688 ACGCGGGAACGCGGGGACGCGGG - Exonic
947992171 2:234496706-234496728 CCGCGGGGACGCCGAGCCCCGGG - Exonic
948206646 2:236166245-236166267 CCGCCGAGCAGCGGCGCCGCGGG - Exonic
948430320 2:237914328-237914350 CCTGGGGGCCCGGGGGCCGCGGG - Intergenic
948473645 2:238203144-238203166 GCGGGGGCCCGCGGTGCCGCCGG + Intronic
948479148 2:238239618-238239640 CCGTGGGGCTGCGGGGCGGGCGG - Intronic
948505969 2:238427127-238427149 GCGCGCGGCCACTGGGCCGCGGG + Intronic
948874380 2:240819308-240819330 GGGAGGGGCTGCGGGGCCGCAGG - Intronic
948893092 2:240916468-240916490 GCGCGGGGGCGCGGGGGCACGGG - Intergenic
949040083 2:241844041-241844063 GCGCGGGGGCGCGGGGGCGCGGG + Intergenic
949040087 2:241844049-241844071 GCGCGGGGGCGCGGGGGCGCGGG + Intergenic
949079869 2:242088467-242088489 GCGCGGGGGCGCGGGGGGGCGGG - Intergenic
949079875 2:242088475-242088497 GCGCGGGGGCGCGGGGGCGCGGG - Intergenic
949079879 2:242088483-242088505 GCGCGGGGGCGCGGGGGCGCGGG - Intergenic
1169130565 20:3164545-3164567 CTGCGGGAGCGCGGGGCCGCAGG - Exonic
1170204694 20:13785297-13785319 CCGCGGGGCGGCGGGGCGGCGGG + Intronic
1172144001 20:32743576-32743598 CCGCGGACACGCGCGGCCGCCGG + Exonic
1172146717 20:32762654-32762676 CGGCTGGGCGGCGGAGCCGCGGG - Exonic
1172284660 20:33732177-33732199 CCGCGGGGCGGGAGGGGCGCGGG + Intronic
1172954668 20:38748001-38748023 CCACGCGGAGGCGGGGCCGCCGG + Intergenic
1175332224 20:58173224-58173246 GCGTGGGGCCGTGGGGCCGTGGG + Intergenic
1175562043 20:59939249-59939271 GCGCGGTGGCGCGGGCCCGCAGG - Exonic
1175859707 20:62143637-62143659 CGGCGGCGCCGCGGGCCCGGAGG + Intergenic
1176042368 20:63072317-63072339 CCAGGGGGCCGCGGGTCCGGGGG + Intergenic
1176147776 20:63573084-63573106 CCGCGGGGCTGTTGGGCAGCAGG + Intronic
1176156985 20:63626923-63626945 CGGGGGGGCCGCGGGCTCGCCGG + Intronic
1176194640 20:63831458-63831480 GCGCCGCGCCGCGGGGTCGCAGG + Intergenic
1176237982 20:64063152-64063174 GCGCGCGGCCGCGGGGCCGAGGG + Exonic
1176377076 21:6092053-6092075 GGGCGGGGCCGAGCGGCCGCGGG + Intergenic
1176550031 21:8217039-8217061 CCGCGGGGCCCCGGCGGCGGGGG + Intergenic
1176568958 21:8400074-8400096 CCGCGGGGCCCCGGCGGCGGGGG + Intergenic
1176576872 21:8444309-8444331 CCGCGGGGCCCCGGCGGCGGGGG + Intergenic
1178417090 21:32412738-32412760 GCGGGGGGCCGCGGAGCCGCTGG + Exonic
1178915062 21:36701439-36701461 CCGGGGAGCCGCGGGGCTGGAGG - Intronic
1179422453 21:41247650-41247672 AGGCGGGGCGGCGGGGCCGTGGG + Intronic
1179511825 21:41878821-41878843 GGCGGGGGCCGCGGGGCCGCGGG + Exonic
1179511844 21:41878889-41878911 GCGCGGGGCCGCGGGGCTGCCGG - Intronic
1179746399 21:43446191-43446213 GGGCGGGGCCGAGCGGCCGCGGG - Intergenic
1179881843 21:44296298-44296320 CCGCAGGGCCTAGGGGCCGCGGG - Intronic
1179902268 21:44400375-44400397 CTGCAGGGCTGCGGGGCTGCGGG + Intronic
1179902276 21:44400399-44400421 CTGTGGGGCTGCGGGGCTGCGGG + Intronic
1180014763 21:45074803-45074825 GCGCGGGGCCGCGGCGGCTCGGG + Intronic
1180064560 21:45405774-45405796 GGGCGGGGCCGCGGGGTCTCGGG + Intronic
1180102119 21:45593263-45593285 CCGTGGGGCGACGGGGCCGTGGG - Intergenic
1180844727 22:18974861-18974883 CTGCGGGGCAGCAGGGCAGCGGG + Intergenic
1180951825 22:19723895-19723917 CCGCCGAGCCGCCCGGCCGCAGG + Exonic
1181056744 22:20263851-20263873 CTGCGGGGCAGCAGGGCAGCGGG - Intronic
1182321334 22:29480093-29480115 CCGGTCGGCCGGGGGGCCGCAGG + Intergenic
1182355952 22:29722274-29722296 CTGCAGGGGCGAGGGGCCGCAGG + Intronic
1182804464 22:33058410-33058432 GCGCGGGGAGGCCGGGCCGCCGG - Intergenic
1183376371 22:37467734-37467756 CCACGGGGCTGCAGGGCCGGGGG + Intergenic
1183427119 22:37746053-37746075 CGGCGGGGCGGCGGGACGGCGGG - Intronic
1183486378 22:38089453-38089475 CCGCGGGGGCCCGGGGCCTCAGG - Intronic
1183546095 22:38455467-38455489 CCGGGAGGCCGAGGGGTCGCGGG - Intergenic
1183708193 22:39487766-39487788 CCGCCGGGCCGAGGAGCCGTTGG - Exonic
1183903347 22:41022188-41022210 GCGCGGGGCGGCGGAGGCGCGGG + Intergenic
1184046770 22:41976902-41976924 GGGCGGCGCGGCGGGGCCGCGGG + Exonic
1184046773 22:41976910-41976932 CGGCGGGGCCGCGGGCCGGGCGG + Exonic
1184412148 22:44331634-44331656 CTGCGGGGACGCGGGGACTCCGG + Intergenic
1184697868 22:46150115-46150137 ACGCGCGGCCGCGGGGCGGGTGG - Intergenic
1184697872 22:46150123-46150145 AGGCGGGGACGCGCGGCCGCGGG - Intergenic
1184759486 22:46536742-46536764 CTGCGCGGCCGCGCAGCCGCCGG + Exonic
1185222409 22:49635800-49635822 CCGCGGGGCTGGGGTGCTGCAGG + Intronic
1185259537 22:49853866-49853888 GCGGCGGGCGGCGGGGCCGCGGG + Exonic
1185385542 22:50530018-50530040 CGGCGGGGCGGCGGCGCCCCAGG + Intronic
1203254921 22_KI270733v1_random:133365-133387 CCGCGGGGCCCCGGCGGCGGGGG + Intergenic
1203262977 22_KI270733v1_random:178444-178466 CCGCGGGGCCCCGGCGGCGGGGG + Intergenic
950021907 3:9793204-9793226 CCGCAGGGGCGCGGGGCCGAGGG + Intronic
950153843 3:10708045-10708067 GCGGGCGGCGGCGGGGCCGCGGG - Intergenic
950487831 3:13283179-13283201 CGGCGCGTCCGCGGGGCAGCGGG - Intergenic
950683890 3:14602968-14602990 CCGCGGGGATGCGGGGCTGGCGG - Intergenic
950683942 3:14603078-14603100 CCGCGGGCCCAGGGAGCCGCGGG + Intergenic
950729823 3:14947758-14947780 CCGCGGGCTCGCGGGGCAGCGGG - Intronic
950729828 3:14947766-14947788 CCCGGGGGCCGCGGGCTCGCGGG - Intronic
951543625 3:23806110-23806132 CGGCGCGGCCGGGGGGCGGCGGG - Intronic
951543657 3:23806176-23806198 CGCCGGGGCCGCCGGGCCGCAGG + Intronic
953657077 3:44862264-44862286 CCGCCGGGGCCCCGGGCCGCGGG + Intronic
953909242 3:46883405-46883427 GCGCCGGGCCCCGGGGCCTCGGG + Exonic
954735794 3:52705788-52705810 CCGCGGGGCAGCCCTGCCGCCGG + Exonic
954882638 3:53846173-53846195 GCGCGGGGCGCCGGCGCCGCCGG - Exonic
956677964 3:71753516-71753538 CCGCGGGGTCGGGAGGCGGCCGG - Intronic
958942924 3:100334887-100334909 CGGCGGGGACGCGGGGCGGAGGG - Intronic
959539829 3:107525126-107525148 CCCCGGCGCCCCTGGGCCGCTGG - Intronic
960582782 3:119294798-119294820 CCCCAGAGCCGCGGGGCAGCCGG + Exonic
961359339 3:126357272-126357294 CCGCCCGGCCGCAGGACCGCCGG - Exonic
961389202 3:126542417-126542439 CCCCGGGGCCGCGGCGGCCCAGG - Exonic
961650366 3:128413971-128413993 CCGAGGGGCCGCTGGGCCCAAGG + Intergenic
961682453 3:128608243-128608265 CTGCCGGCCCGCGGGGCAGCCGG + Intergenic
962259976 3:133895914-133895936 CCGCGGGGCTGCGGGGCTGGGGG + Intergenic
962738864 3:138348665-138348687 CCGCCGGGCCCCGCGGCCGCCGG - Intronic
963081845 3:141402240-141402262 CCCCGGGCCCGCGGGGCTGCGGG + Intronic
963503848 3:146161023-146161045 GCGCGGCGCTGCGGGGCCGTGGG - Exonic
964118816 3:153162097-153162119 CCGCGGGGCCGGGAGGGGGCGGG - Intergenic
965597055 3:170419959-170419981 CTGCGGGGCTGCGGTGACGCCGG + Intronic
966696330 3:182793705-182793727 CGCGGGGGCCGCGGGGCTGCAGG - Exonic
966696332 3:182793713-182793735 CCGCGGGGCGCGGGGGCCGCGGG - Exonic
967916725 3:194583908-194583930 CGGCGGCGGGGCGGGGCCGCGGG + Intergenic
967998047 3:195181279-195181301 CTGCGTGGCTGCGGGGCTGCGGG + Intronic
968235813 3:197029593-197029615 CAGCCGGGCCGCGGCGCCCCGGG + Intronic
968353203 3:198080245-198080267 CCCAGGGGCTGCGGGGCTGCGGG + Intergenic
968353206 3:198080253-198080275 CTGCGGGGCTGCGGGGAAGCCGG + Intergenic
968514910 4:1011843-1011865 GCCCGGGGGCGCGGGGCGGCGGG + Intronic
968659766 4:1794114-1794136 CCCCGGGTCGGAGGGGCCGCCGG + Intronic
968671689 4:1855719-1855741 CTGCGGGACCGTGGGGCCCCGGG - Intronic
968674575 4:1870901-1870923 GCGCGGGGCCTGGGGCCCGCGGG - Intergenic
968803196 4:2756304-2756326 CCGGGAGGCCGCGCGGCCGCCGG + Exonic
969239204 4:5888197-5888219 GCGCGGGGCGGCGGGGGCGGGGG + Intronic
969597833 4:8158897-8158919 CCGGGCGGCAGCGGGGGCGCGGG - Intergenic
970332935 4:15003478-15003500 TGGCGGCGCCGCGGGGCTGCAGG - Exonic
971351815 4:25862618-25862640 GCGCGGGGCCCCGGGGACGCGGG - Intronic
971457369 4:26857687-26857709 GCGCGGGGCTGCGGTGGCGCAGG + Intronic
972321584 4:37977429-37977451 CCGCCGGCCCGTGGGCCCGCGGG - Intronic
973945341 4:55949152-55949174 CCGGGAGGCCGCGCGGCCGCGGG + Intronic
978777049 4:112515267-112515289 GCGCGGGGCGGCGTGGCTGCGGG - Exonic
978778358 4:112524102-112524124 CCGCGGGGCTTCGGGGCCGCGGG + Intergenic
981093459 4:140756281-140756303 TCGCGGGGCGGCGACGCCGCGGG - Intergenic
981550542 4:145937557-145937579 GCGCCGGGGCGCGGGGCGGCCGG - Intronic
984811101 4:183797364-183797386 CCGCGGGGCCGCTGGGCGCCCGG + Intergenic
984928451 4:184826317-184826339 TCGCGGGGCCCAGGGTCCGCGGG - Intronic
985696612 5:1344649-1344671 CCGCGGGGCCGGGGGCCGGGCGG - Intronic
986190785 5:5494698-5494720 CCGCTGGGCCTCAGGGCCTCAGG - Intergenic
986190788 5:5494706-5494728 GGGCGGGGCCGCTGGGCCTCAGG - Intergenic
986315344 5:6583171-6583193 CCGCTGGGCTGAGGAGCCGCGGG + Intergenic
986330770 5:6714481-6714503 GCGCGGGGCCGCGCGGCCCGGGG - Intergenic
986330774 5:6714488-6714510 CCGCGCGGCCCCGCGCCCGCCGG + Intergenic
986402967 5:7396658-7396680 CCACCGGGCCGCGGGCCAGCAGG - Intronic
986733182 5:10649798-10649820 CTGCGGGGCCCCGGGACCCCAGG - Exonic
987153730 5:15066926-15066948 CCGCAGGGCTGGGGGGCCTCAGG + Intergenic
987258252 5:16179435-16179457 GCGCGGGGCCGCGGGGACCGGGG + Exonic
987374009 5:17217825-17217847 CCGCGGCGGCGCGGGGCCACCGG - Intronic
987374014 5:17217833-17217855 CCCCGGGTCCGCGGCGGCGCGGG - Intronic
988578027 5:32444912-32444934 CCGCGCGGCCGCGGGGCGACGGG + Intergenic
990955459 5:61333951-61333973 CTGCCGCGCCGCGGGGACGCGGG - Intronic
992473187 5:77077512-77077534 CAGCGGGGCCGGGCGGCGGCGGG + Exonic
992663544 5:78984707-78984729 CGGCCGGGGCGCGGGTCCGCGGG + Intronic
992671909 5:79069679-79069701 CCGCGGGGCCGGCGGGGCGGGGG + Intronic
994710600 5:103259445-103259467 CCGCGGGGCAGCGGGCCTGGAGG + Intronic
995724812 5:115170830-115170852 CCGCGGGGGTGCGGGGGTGCCGG - Intronic
996379035 5:122845508-122845530 CCGCGGGGCCCCGAGGCTGCGGG - Exonic
996404100 5:123089874-123089896 CCGCGGAACCGGGCGGCCGCCGG + Intronic
997201301 5:132011597-132011619 CTGCGGGGCTGCGGGGCTGCGGG - Exonic
997201304 5:132011605-132011627 CTGCTGGGCTGCGGGGCTGCGGG - Exonic
998797521 5:145835497-145835519 CCGCGGGGCCCCGGGTGCTCTGG - Intergenic
999188914 5:149731917-149731939 CCGCGGGGCCGCGTGGTCGGTGG + Intronic
999248264 5:150166962-150166984 GGGCGGGGCCGGGGGGCCGTAGG - Exonic
999375123 5:151081171-151081193 CCGCGGGCCCCCGGAACCGCAGG - Intronic
999727044 5:154446099-154446121 CCGCGGGGCCCGGGTGCCGCGGG + Exonic
1001159527 5:169300973-169300995 CCGCGGGCCAGCGGGGCCAGGGG - Intronic
1001381986 5:171311329-171311351 ACCCGGCACCGCGGGGCCGCCGG - Intronic
1001556746 5:172641890-172641912 CCGCGGGGGCGCTGGGAGGCTGG - Intronic
1001773418 5:174312027-174312049 GCGCGGGGGCGCGGGGGCTCGGG + Intergenic
1002094777 5:176824294-176824316 CCTCAGGGCCTCGGGGCCACTGG - Intronic
1002189978 5:177473133-177473155 CCGCAGGGCCACGCGGCCCCGGG + Exonic
1002600602 5:180352476-180352498 CCGCGTGGCTGCGGGACCGTGGG - Intronic
1002715324 5:181223559-181223581 CCGCGGGGCCCCAGGGCGACAGG - Exonic
1003062832 6:2876089-2876111 CCGCGGGGCAGCGCGGGCGCGGG + Intergenic
1003112131 6:3259230-3259252 GGGCGGGGGCGCGGGGGCGCCGG + Intronic
1003175901 6:3751981-3752003 CCTCGCGGCCCCGGAGCCGCAGG + Exonic
1003427452 6:6007230-6007252 CGGCGGGGCTGGGGGGCCCCCGG - Intronic
1003624303 6:7727854-7727876 CGGCCGGGCCGCGGGGCTCCGGG + Intronic
1004044512 6:12011928-12011950 CCGCGGGTGGGCGGGGCGGCAGG - Intronic
1004044568 6:12012080-12012102 CCCTGGGGCCGCGGGGCCCGGGG - Intronic
1006512124 6:34527170-34527192 CCGCTGCGCCGCGGGGCGGGGGG + Intronic
1006737554 6:36285299-36285321 CTGCGAGGCGGCGGCGCCGCCGG - Intronic
1007072835 6:39049175-39049197 CCGCGGGGCAGCGGGTGCCCGGG - Intronic
1007072838 6:39049183-39049205 CAGGGCGGCCGCGGGGCAGCGGG - Intronic
1007431523 6:41779912-41779934 CCCCGCGGCCGCGGGGTCGGAGG + Intronic
1007644447 6:43369503-43369525 CCGGGGCGACGCGGGGCCGAGGG - Intergenic
1009893492 6:69718548-69718570 CCGCAGGGCTGCGAGGCCTCAGG + Intronic
1009940485 6:70283018-70283040 GCGCGGGACCGCGGGGCCCTGGG - Intronic
1010032911 6:71288897-71288919 GCGCGGGGCTGCGGGGCTGCGGG - Exonic
1010703237 6:79077569-79077591 CCGCCGGGGCGCGGGGCGGGCGG - Intronic
1011607378 6:89118102-89118124 CGGCGCGGCCCAGGGGCCGCGGG + Intergenic
1012410123 6:98947635-98947657 GCGCGGGGGCGCGGGGCCGCGGG + Intronic
1012550955 6:100464560-100464582 CCGCGGAGCTGCGGGGCTGCTGG + Intronic
1013230562 6:108158010-108158032 CGGGGGGGCGGCGCGGCCGCGGG - Intronic
1013230578 6:108158043-108158065 CCGCGGGGCTTCGGGACTGCAGG - Intronic
1014137592 6:117907393-117907415 GCGCGGGGGCGCGGAGCTGCCGG - Intergenic
1014205534 6:118651631-118651653 CCGCGAGGGGGCGGGGCCTCGGG + Intronic
1014246901 6:119078819-119078841 CCGCGGGGCTGCGGGACTGGCGG - Intronic
1016386772 6:143537114-143537136 CCGCGGGGGCTCGGGTCCCCGGG - Intronic
1016439009 6:144064539-144064561 CGGCGGGTCCGGGCGGCCGCTGG + Intronic
1017672479 6:156779504-156779526 TCGCGGCGCGGCGAGGCCGCCGG - Intronic
1017738232 6:157381967-157381989 CCGCGCGGCCGGGGGGCTCCTGG + Exonic
1017954879 6:159169442-159169464 CCGCGGGGCAGGGGCGCGGCGGG + Exonic
1018926785 6:168212424-168212446 CAGGGGGGCAGCGGGGCAGCAGG + Intergenic
1019059764 6:169248654-169248676 CAGCGTGTCCGCGGGGCCGTTGG + Exonic
1019279262 7:192141-192163 CCGCGGGGCGTCTGCGCCGCCGG - Intergenic
1019395731 7:816745-816767 CCCGGGGGCCGGGGGGACGCGGG + Intronic
1019474369 7:1236823-1236845 CGGCGGGGGCGCGGGGCCGGCGG - Exonic
1019663904 7:2241935-2241957 CGGCGGGGCCGTGGGGAGGCCGG - Intronic
1019719417 7:2559281-2559303 GCGCGGGGCCCCGAGGCTGCGGG - Intronic
1020002956 7:4765971-4765993 CCACGGAGCCGCGGGGCCAGAGG + Exonic
1022094464 7:27130261-27130283 TCGCAGCGCCGCGGGGCCGCTGG + Exonic
1022427679 7:30284618-30284640 CCGCGGAGCGGCGCGGCTGCAGG - Exonic
1023805346 7:43869255-43869277 CCTGGGGGCCGGGGGGCCGGGGG - Intronic
1024216619 7:47254251-47254273 CCGCAGGGCAGCGGGGGCGGAGG + Intergenic
1025174004 7:56787650-56787672 TGGCGGGGCCGCGAGGTCGCCGG - Intergenic
1025698097 7:63790305-63790327 TGGCGGGGCCGCGAGGTCGCCGG + Intergenic
1025829812 7:65038775-65038797 TGGCGGGGCCGCGAGGCAGCCGG + Intergenic
1025917067 7:65873775-65873797 TGGCGGGGCCGCGAGGCAGCCGG + Intronic
1026471018 7:70694289-70694311 GCGCGGGGCGGCGGCGCCTCTGG - Intronic
1026807099 7:73435470-73435492 CCGCGGGGCCCGGAGGCCGGAGG + Exonic
1029139649 7:98400889-98400911 CGGCTGGGCCTCGTGGCCGCCGG + Exonic
1029139723 7:98401140-98401162 GGGCGGGGCCGCAGGGCCGGAGG + Intergenic
1029286404 7:99468804-99468826 TCGCGGGGACGCAGAGCCGCCGG + Intergenic
1029461050 7:100694079-100694101 GCCGGGGGCCGCGGGGCCACTGG + Intergenic
1029570043 7:101363198-101363220 GCTCGGGGCCGAGGGGCCGGGGG + Intronic
1029570195 7:101363606-101363628 CCGCGGGGCTGCGGGGCTGCGGG + Intronic
1029570198 7:101363614-101363636 CTGCGGGGCTGCGGGGTTGCGGG + Intronic
1029849328 7:103446065-103446087 GCGGGCGGCCGCGGGGCCGGGGG - Intronic
1030227637 7:107169683-107169705 TCGCGGAGCCGCTGGGCCCCGGG + Intronic
1031317288 7:120273407-120273429 CGGCGGGGCTGCGGGGCGGCCGG - Intergenic
1031317291 7:120273415-120273437 CTGCGGGGCGGCGGGGCTGCGGG - Intergenic
1031317294 7:120273423-120273445 GTGCGGGGCTGCGGGGCGGCGGG - Intergenic
1032021660 7:128409984-128410006 CCGAGGAGGGGCGGGGCCGCCGG + Exonic
1032092140 7:128916230-128916252 ACGCGGGGACGCGGGGACGCGGG + Intergenic
1033159064 7:138981177-138981199 CCCCGGGGCCGAGCGGCCGACGG - Exonic
1034197944 7:149262365-149262387 CCGGGCGTCCGCGGGGCCGAGGG - Intronic
1034201428 7:149285326-149285348 TCGCGGGGCCGCCGGGGCTCGGG - Intronic
1034222965 7:149460075-149460097 ACGCGCGGCCTCGGGGCCCCGGG - Intronic
1034228068 7:149497933-149497955 TCGCGGGGTCGCGGGGTCGCGGG - Intergenic
1034560627 7:151877330-151877352 CCCTGGGGCCGCGGCGCGGCGGG - Intergenic
1035381824 7:158445496-158445518 CCGAGAGGCCGCGGGGTCACTGG - Intronic
1035580537 8:737243-737265 TCGCGGGGCAGAGGGGACGCGGG - Intronic
1035751959 8:2002501-2002523 CCCCGGGGCAGCGGCGCCACGGG - Exonic
1035752029 8:2002823-2002845 CTGCAGGCCCGTGGGGCCGCCGG - Exonic
1036578827 8:10054400-10054422 CCGGGGGGCGGCAGGGGCGCGGG - Exonic
1036803208 8:11808368-11808390 GGGCGGGGCTGCGGGGCTGCGGG + Intronic
1036910538 8:12754575-12754597 CCCCGGGGCCGCTGGGCCGCTGG - Intronic
1037815359 8:22109104-22109126 CCCCGGGCCCGCCGGGCCTCGGG - Intronic
1037860252 8:22399736-22399758 CTGAGGGGCCGAGGGGCCGCTGG + Intronic
1037879434 8:22565776-22565798 CCGCTGGGTCCCGGGGTCGCGGG + Intronic
1037897678 8:22668987-22669009 CCGCGGACCCGCGAGGCCCCTGG - Intronic
1038010562 8:23472547-23472569 CCGCGGGGCAGCAAGGCGGCAGG + Intergenic
1039630585 8:39107697-39107719 ACGCGGGGACGCGCGGACGCCGG - Exonic
1039794121 8:40897688-40897710 CCGCGAGGCAGAGGGGCCGCCGG + Exonic
1040038880 8:42896880-42896902 GGGCGGGGACGCGGGGCGGCGGG + Intronic
1040077161 8:43247460-43247482 CTGCGGGGCTGCGGGGCTGCGGG - Intergenic
1040077164 8:43247468-43247490 CTGCGGGGCTGCGGGGCTGCGGG - Intergenic
1040077167 8:43247476-43247498 CTACGGGGCTGCGGGGCTGCGGG - Intergenic
1040471420 8:47738235-47738257 CGGGGGCGCCCCGGGGCCGCGGG + Exonic
1041689850 8:60678527-60678549 GCGCGGAGCTGCTGGGCCGCGGG - Intergenic
1042235781 8:66612678-66612700 CCAAGCGGCCGCGGGGACGCGGG + Intronic
1044988690 8:97776384-97776406 CCGCGGGGCTGCGCGGAGGCTGG - Intronic
1045277636 8:100721854-100721876 CTGCGGGGCCGCGGGCGGGCGGG + Exonic
1045663967 8:104466626-104466648 CCGCGGGGCGGGGGCGCGGCGGG + Intronic
1047951494 8:129939442-129939464 CCGGGGCGTCGCGGGGCCGGGGG + Intronic
1049109755 8:140635517-140635539 CCGAGGGGCTCCGGGGCCGAGGG + Exonic
1049162064 8:141103925-141103947 CCGCGGGGCCTCGGGGAGGCCGG + Intergenic
1049419547 8:142510758-142510780 CCGCGGGGCCTGGCGGCGGCGGG + Intronic
1049467126 8:142756723-142756745 TCGCGGGGCTTCTGGGCCGCAGG - Intergenic
1049585408 8:143430506-143430528 CGGCGGGGGCGGGGGGGCGCCGG + Intergenic
1049585416 8:143430528-143430550 GCGCGGGGCGGCGGCGCCGAGGG + Intergenic
1049602943 8:143516334-143516356 GAGCAGGGCCACGGGGCCGCTGG + Intronic
1049762665 8:144338150-144338172 GCGCGGGGCCGGGCGGCCGGGGG - Intergenic
1049789715 8:144467002-144467024 CCGCGCGGCCGCGGTGTCCCTGG + Exonic
1049850260 8:144826948-144826970 CCGCGGGGTCGCAGAGCCTCCGG - Intergenic
1053003368 9:34589871-34589893 GCGCGCGGCCGCGGAGGCGCGGG - Intronic
1053149168 9:35732100-35732122 CGGCGGGGCGGCGGGCCGGCGGG - Exonic
1053372659 9:37576010-37576032 CCGGGGGACCGCGGAGCCGCGGG + Intronic
1056350073 9:85741379-85741401 CCGAGGGGCTGCAGGGCCGGGGG - Intronic
1056475415 9:86947308-86947330 ACGCGGGGCGGCCGGGCCGCGGG - Intergenic
1056757388 9:89390362-89390384 CTGCGGGGCTGCGGGGCAGCTGG + Intronic
1057198451 9:93127843-93127865 CCGGGAGGCCGGGGTGCCGCAGG + Intronic
1057198454 9:93127851-93127873 CCGGGGTGCCGCAGGGCCACAGG + Intronic
1057245594 9:93451862-93451884 GCGGGGGGCGGCGGGGCCGGGGG - Exonic
1057432163 9:95004731-95004753 GCGCGGGGGCGCGGGGCGGCCGG + Intronic
1057432187 9:95004783-95004805 GCGCGGGGGCGCGGGGCGGCCGG + Intronic
1057490498 9:95516382-95516404 GCGCGGGGACACGGGGACGCGGG - Intronic
1057772952 9:97983796-97983818 CCGCGGGCCCCTGGGGCGGCCGG + Intronic
1057921952 9:99105025-99105047 CGGCGGGGAGGCGGGGCCGGCGG + Intronic
1058413845 9:104764399-104764421 CGGCGGCGGCGCGGGGCCCCAGG - Intronic
1058885736 9:109320356-109320378 GCGCGGGGCCGCCGGGCTGGGGG - Exonic
1058885741 9:109320364-109320386 GCGGCGGGGCGCGGGGCCGCCGG - Exonic
1059176731 9:112175142-112175164 CCGCGGCGCCGCGGGAGCGCCGG - Exonic
1059191862 9:112333938-112333960 CCGCGGGGCCGCGGGAGGGCGGG - Intergenic
1059191868 9:112333946-112333968 CGGAAGGCCCGCGGGGCCGCGGG - Intergenic
1059234500 9:112750690-112750712 CCGGGCGGCCGCGGCGCCTCGGG + Intergenic
1060087277 9:120714205-120714227 CGGCGGGGCCGCGGGGCAGGTGG - Exonic
1060106664 9:120877090-120877112 CCGCGAGGCTGCGTGTCCGCCGG + Exonic
1060152923 9:121300014-121300036 CCGGGGGGCCCCGGGGCTCCCGG + Intronic
1061000518 9:127899667-127899689 GGGCGGAGCCTCGGGGCCGCGGG + Intronic
1061317090 9:129803158-129803180 CCGCTTGGCCGCGGGGCGCCTGG + Exonic
1061453547 9:130681755-130681777 CCGCGGCGGCGCCGGGCCGGGGG - Exonic
1061541074 9:131278022-131278044 CCGCGGGGATGCAGGTCCGCAGG + Intergenic
1061559682 9:131394360-131394382 CCGCAGGGCCCCCGGGCCCCCGG - Intronic
1061559715 9:131394444-131394466 CTGCGGGGCTGGGAGGCCGCGGG + Intronic
1061559724 9:131394460-131394482 CCGCGGGGCCTGGGGGCGGCGGG + Intronic
1061700325 9:132410537-132410559 CCGCGGGGCCAGGGCGCTGCGGG - Intronic
1062001828 9:134219841-134219863 CCACGGGGCCACGGGGCCACGGG - Intergenic
1062022562 9:134326358-134326380 CCGCGGCGCTGCGGCGCCGGCGG - Intronic
1062022580 9:134326397-134326419 GCGCGCGGCGGCGGGGGCGCGGG + Intronic
1062022744 9:134326879-134326901 CGGCGGGGCCGGGGGGCGGGTGG + Intronic
1062364723 9:136203209-136203231 CGGCCGGGGGGCGGGGCCGCGGG + Intronic
1062544111 9:137054064-137054086 GGGCGGGGCCGCGGGACCGCGGG + Intergenic
1062556211 9:137114412-137114434 CCGGGGGGCGGCGGGACGGCGGG + Intronic
1062560470 9:137139385-137139407 CCGCGGGGCCGGGCGAGCGCAGG + Intronic
1062569952 9:137180413-137180435 CTGCGGGGCGGCCGGGCAGCGGG + Intronic
1062574535 9:137200161-137200183 CCGCGGGGCCCGGGCGCGGCGGG + Exonic
1062574577 9:137200262-137200284 CCGCCGCGCCGCGCCGCCGCGGG - Exonic
1062574580 9:137200263-137200285 CCGCGGCGGCGCGGCGCGGCGGG + Exonic
1062600354 9:137316391-137316413 CCCAGGGGCCGCGGGGTCGCTGG + Intronic
1062676928 9:137752182-137752204 TCGCGGGGCGGGGGCGCCGCCGG - Intronic
1062696342 9:137877994-137878016 GCCCGGGGCGGCGGGGCCGGCGG + Exonic
1203794555 EBV:169690-169712 CGGGGGGGCTGGGGGGCCGCGGG - Intergenic
1203794756 EBV:170228-170250 CGGGGGGGCTGGGGGGCCGCGGG - Intergenic
1203794947 EBV:170751-170773 CGGGGGGGCTGGGGGGCCGCGGG - Intergenic
1203795148 EBV:171289-171311 CGGGGGGGCTGGGGGGCCGCGGG - Intergenic
1203471323 Un_GL000220v1:116511-116533 CCGCGGGGCCCCGGCGGCGGGGG + Intergenic
1203479144 Un_GL000220v1:160483-160505 CCGCGGGGCCCCGGCGGCGGGGG + Intergenic
1187888037 X:23907545-23907567 CCGCGGGGCCGGGACGCAGCCGG + Intronic
1190285306 X:48957470-48957492 CCGCCGCGCCGCGGCGCCGGGGG + Exonic
1190881569 X:54495712-54495734 CGGCGGGGCCGGGGGCCCGCTGG + Exonic
1192630953 X:72777481-72777503 GCGGGGGGCGGCGGGGGCGCGGG - Intronic
1192630957 X:72777489-72777511 CTGCGGGGGCGGGGGGCGGCGGG - Intronic
1192650752 X:72943312-72943334 CTGCGGGGGCGGGGGGCGGCGGG + Intronic
1192650756 X:72943320-72943342 GCGGGGGGCGGCGGGGGCGCGGG + Intronic
1192656909 X:73002739-73002761 CTGCGGGGCTGCCGGGCTGCGGG - Intergenic
1192656912 X:73002747-73002769 CTGCGGGGCTGCGGGGCTGCCGG - Intergenic
1192656914 X:73002755-73002777 CTGCGGGGCTGCGGGGCTGCGGG - Intergenic
1192656917 X:73002763-73002785 CTGCGGGGCTGCGGGGCTGCGGG - Intergenic
1192656920 X:73002771-73002793 CTGCGGGGCTGCGGGGCTGCGGG - Intergenic
1192656923 X:73002779-73002801 CTGCGGGGCTGCGGGGCTGCGGG - Intergenic
1192656926 X:73002787-73002809 CTGCGGGGCTGCGGGGCTGCGGG - Intergenic
1192656929 X:73002795-73002817 CTGCGGGGCTGCGGGGCTGCGGG - Intergenic
1192656932 X:73002803-73002825 CTGCGGGGCTGCGGGGCTGCGGG - Intergenic
1192656935 X:73002811-73002833 CTGCGGGGCTGCGGGGCTGCGGG - Intergenic
1192665185 X:73080190-73080212 CTGCGGGGCTGCGGGGCTGCGGG + Intergenic
1192665188 X:73080198-73080220 CTGCGGGGCTGCGGGGCTGCGGG + Intergenic
1192665191 X:73080206-73080228 CTGCGGGGCTGCGGGGCTGCGGG + Intergenic
1192665194 X:73080214-73080236 CTGCGGGGCTGCGGGGCTGCGGG + Intergenic
1192665197 X:73080222-73080244 CTGCGGGGCTGCGGGGCTGCGGG + Intergenic
1192665200 X:73080230-73080252 CTGCGGGGCTGCGGGGCTGCGGG + Intergenic
1192665203 X:73080238-73080260 CTGCGGGGCTGCGGGGCTGCGGG + Intergenic
1192665206 X:73080246-73080268 CTGCGGGGCTGCGGGGCTGCGGG + Intergenic
1192665208 X:73080254-73080276 CTGCGGGGCTGCGGGGCTGCCGG + Intergenic
1192665211 X:73080262-73080284 CTGCGGGGCTGCCGGGCTGCGGG + Intergenic
1196085735 X:111681087-111681109 CCAGGGGGCGGCGGGGCCCCGGG - Intronic
1197746075 X:129932705-129932727 CCTCGGCGCCCCGTGGCCGCAGG + Intergenic
1198296823 X:135295547-135295569 CAGCGAGGCCGCCTGGCCGCAGG - Intronic
1198807301 X:140504749-140504771 TCCCGGGGCTGCGGGGCCGCCGG + Exonic
1200098203 X:153673902-153673924 CAGCGCGGCCGCGGCGCCGCAGG + Intronic
1200100794 X:153688436-153688458 CCGGGGGGCGGCCGGGCCGGGGG - Exonic
1200249885 X:154547181-154547203 CCGCGAGCGCGCGAGGCCGCCGG - Exonic
1200330512 X:155291932-155291954 TCGCATGGCCGCGGGGCTGCGGG - Intronic
1200418259 Y:2935454-2935476 CCGCGTGCCCCCGCGGCCGCGGG + Intronic