ID: 940009949

View in Genome Browser
Species Human (GRCh38)
Location 2:149041915-149041937
Sequence CTCTATGGTGGCAATTCTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940009944_940009949 4 Left 940009944 2:149041888-149041910 CCCAATAGTAATAGCAACAGTGG No data
Right 940009949 2:149041915-149041937 CTCTATGGTGGCAATTCTCAAGG No data
940009946_940009949 3 Left 940009946 2:149041889-149041911 CCAATAGTAATAGCAACAGTGGC No data
Right 940009949 2:149041915-149041937 CTCTATGGTGGCAATTCTCAAGG No data
940009943_940009949 11 Left 940009943 2:149041881-149041903 CCATACTCCCAATAGTAATAGCA No data
Right 940009949 2:149041915-149041937 CTCTATGGTGGCAATTCTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940009949 Original CRISPR CTCTATGGTGGCAATTCTCA AGG Intronic
No off target data available for this crispr