ID: 940011534

View in Genome Browser
Species Human (GRCh38)
Location 2:149060019-149060041
Sequence AGGGAGAAGGAGGAGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940011527_940011534 -4 Left 940011527 2:149060000-149060022 CCTTGAGGGAGGGGTAGGGAGGG No data
Right 940011534 2:149060019-149060041 AGGGAGAAGGAGGAGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940011534 Original CRISPR AGGGAGAAGGAGGAGGAGGA GGG Intronic
No off target data available for this crispr