ID: 940011599

View in Genome Browser
Species Human (GRCh38)
Location 2:149060579-149060601
Sequence GGGTTTGGCTGAGACCTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940011593_940011599 -2 Left 940011593 2:149060558-149060580 CCTGCATTTGTGAGTTTCCTGGG No data
Right 940011599 2:149060579-149060601 GGGTTTGGCTGAGACCTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940011599 Original CRISPR GGGTTTGGCTGAGACCTGGC TGG Intronic
No off target data available for this crispr