ID: 940015032

View in Genome Browser
Species Human (GRCh38)
Location 2:149095316-149095338
Sequence AAATAAAGGCAAAAGTTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940015028_940015032 25 Left 940015028 2:149095268-149095290 CCTGAGAAACAAGAGCAAAACTC No data
Right 940015032 2:149095316-149095338 AAATAAAGGCAAAAGTTGGAAGG No data
940015027_940015032 29 Left 940015027 2:149095264-149095286 CCAGCCTGAGAAACAAGAGCAAA No data
Right 940015032 2:149095316-149095338 AAATAAAGGCAAAAGTTGGAAGG No data
940015029_940015032 3 Left 940015029 2:149095290-149095312 CCATATTTAAATAAAAAAATAAA No data
Right 940015032 2:149095316-149095338 AAATAAAGGCAAAAGTTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940015032 Original CRISPR AAATAAAGGCAAAAGTTGGA AGG Intronic
No off target data available for this crispr