ID: 940016093

View in Genome Browser
Species Human (GRCh38)
Location 2:149106631-149106653
Sequence ATCAATATCAAAAAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940016093_940016097 19 Left 940016093 2:149106631-149106653 CCTTCCTCCTTTTTGATATTGAT No data
Right 940016097 2:149106673-149106695 ATTTTCCTAATCAATCTGTATGG No data
940016093_940016098 23 Left 940016093 2:149106631-149106653 CCTTCCTCCTTTTTGATATTGAT No data
Right 940016098 2:149106677-149106699 TCCTAATCAATCTGTATGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940016093 Original CRISPR ATCAATATCAAAAAGGAGGA AGG (reversed) Intronic
No off target data available for this crispr