ID: 940016485 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:149111399-149111421 |
| Sequence | ATGAAAAATCAGTCTGATTT GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 940016480_940016485 | 9 | Left | 940016480 | 2:149111367-149111389 | CCAGGCCTAAGGAGTTGGTAGTG | No data | ||
| Right | 940016485 | 2:149111399-149111421 | ATGAAAAATCAGTCTGATTTGGG | No data | ||||
| 940016482_940016485 | 4 | Left | 940016482 | 2:149111372-149111394 | CCTAAGGAGTTGGTAGTGGTGAA | No data | ||
| Right | 940016485 | 2:149111399-149111421 | ATGAAAAATCAGTCTGATTTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 940016485 | Original CRISPR | ATGAAAAATCAGTCTGATTT GGG | Intronic | ||
| No off target data available for this crispr | |||||