ID: 940016485

View in Genome Browser
Species Human (GRCh38)
Location 2:149111399-149111421
Sequence ATGAAAAATCAGTCTGATTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940016480_940016485 9 Left 940016480 2:149111367-149111389 CCAGGCCTAAGGAGTTGGTAGTG No data
Right 940016485 2:149111399-149111421 ATGAAAAATCAGTCTGATTTGGG No data
940016482_940016485 4 Left 940016482 2:149111372-149111394 CCTAAGGAGTTGGTAGTGGTGAA No data
Right 940016485 2:149111399-149111421 ATGAAAAATCAGTCTGATTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940016485 Original CRISPR ATGAAAAATCAGTCTGATTT GGG Intronic
No off target data available for this crispr