ID: 940018967

View in Genome Browser
Species Human (GRCh38)
Location 2:149136473-149136495
Sequence CTGGTGACCCACTGCCATCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940018967_940018970 -1 Left 940018967 2:149136473-149136495 CCCAGATGGCAGTGGGTCACCAG No data
Right 940018970 2:149136495-149136517 GCCATCTTATTTTATGCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940018967 Original CRISPR CTGGTGACCCACTGCCATCT GGG (reversed) Intronic
No off target data available for this crispr