ID: 940022615

View in Genome Browser
Species Human (GRCh38)
Location 2:149171292-149171314
Sequence ATTCCATGCCCTTCTCCTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940022611_940022615 20 Left 940022611 2:149171249-149171271 CCAAGTCTTTTATTACTGTCCAC No data
Right 940022615 2:149171292-149171314 ATTCCATGCCCTTCTCCTTGAGG No data
940022612_940022615 1 Left 940022612 2:149171268-149171290 CCACAACATTTATAGCCAAGTCC No data
Right 940022615 2:149171292-149171314 ATTCCATGCCCTTCTCCTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940022615 Original CRISPR ATTCCATGCCCTTCTCCTTG AGG Intronic