ID: 940022615 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:149171292-149171314 |
| Sequence | ATTCCATGCCCTTCTCCTTG AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 940022611_940022615 | 20 | Left | 940022611 | 2:149171249-149171271 | CCAAGTCTTTTATTACTGTCCAC | No data | ||
| Right | 940022615 | 2:149171292-149171314 | ATTCCATGCCCTTCTCCTTGAGG | No data | ||||
| 940022612_940022615 | 1 | Left | 940022612 | 2:149171268-149171290 | CCACAACATTTATAGCCAAGTCC | No data | ||
| Right | 940022615 | 2:149171292-149171314 | ATTCCATGCCCTTCTCCTTGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 940022615 | Original CRISPR | ATTCCATGCCCTTCTCCTTG AGG | Intronic | ||