ID: 940033484

View in Genome Browser
Species Human (GRCh38)
Location 2:149289098-149289120
Sequence CCACCACCCCACCCCACCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940033484_940033492 9 Left 940033484 2:149289098-149289120 CCAGGGGTGGGGTGGGGTGGTGG No data
Right 940033492 2:149289130-149289152 ATCATTCTTGGTCAATGCATGGG No data
940033484_940033493 14 Left 940033484 2:149289098-149289120 CCAGGGGTGGGGTGGGGTGGTGG No data
Right 940033493 2:149289135-149289157 TCTTGGTCAATGCATGGGTCAGG No data
940033484_940033494 27 Left 940033484 2:149289098-149289120 CCAGGGGTGGGGTGGGGTGGTGG No data
Right 940033494 2:149289148-149289170 ATGGGTCAGGCCAATATGCCAGG No data
940033484_940033495 28 Left 940033484 2:149289098-149289120 CCAGGGGTGGGGTGGGGTGGTGG No data
Right 940033495 2:149289149-149289171 TGGGTCAGGCCAATATGCCAGGG No data
940033484_940033491 8 Left 940033484 2:149289098-149289120 CCAGGGGTGGGGTGGGGTGGTGG No data
Right 940033491 2:149289129-149289151 AATCATTCTTGGTCAATGCATGG No data
940033484_940033490 -3 Left 940033484 2:149289098-149289120 CCAGGGGTGGGGTGGGGTGGTGG No data
Right 940033490 2:149289118-149289140 TGGGGGGCTGAAATCATTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940033484 Original CRISPR CCACCACCCCACCCCACCCC TGG (reversed) Intergenic
No off target data available for this crispr