ID: 940033495

View in Genome Browser
Species Human (GRCh38)
Location 2:149289149-149289171
Sequence TGGGTCAGGCCAATATGCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940033484_940033495 28 Left 940033484 2:149289098-149289120 CCAGGGGTGGGGTGGGGTGGTGG No data
Right 940033495 2:149289149-149289171 TGGGTCAGGCCAATATGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940033495 Original CRISPR TGGGTCAGGCCAATATGCCA GGG Intergenic
No off target data available for this crispr