ID: 940040489

View in Genome Browser
Species Human (GRCh38)
Location 2:149354694-149354716
Sequence TTTCACTGTACAGCATAAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940040481_940040489 16 Left 940040481 2:149354655-149354677 CCATGAGACGAGTCCATCAACCA No data
Right 940040489 2:149354694-149354716 TTTCACTGTACAGCATAAGGGGG No data
940040482_940040489 3 Left 940040482 2:149354668-149354690 CCATCAACCACCTGCTCACCTTT No data
Right 940040489 2:149354694-149354716 TTTCACTGTACAGCATAAGGGGG No data
940040483_940040489 -4 Left 940040483 2:149354675-149354697 CCACCTGCTCACCTTTTCTTTTC No data
Right 940040489 2:149354694-149354716 TTTCACTGTACAGCATAAGGGGG No data
940040484_940040489 -7 Left 940040484 2:149354678-149354700 CCTGCTCACCTTTTCTTTTCACT No data
Right 940040489 2:149354694-149354716 TTTCACTGTACAGCATAAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940040489 Original CRISPR TTTCACTGTACAGCATAAGG GGG Intronic