ID: 940044020

View in Genome Browser
Species Human (GRCh38)
Location 2:149390378-149390400
Sequence AAATGCTCACTGGTTCTTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940044015_940044020 17 Left 940044015 2:149390338-149390360 CCTCAGGGGAGACCCTCCTACAT No data
Right 940044020 2:149390378-149390400 AAATGCTCACTGGTTCTTACTGG No data
940044017_940044020 4 Left 940044017 2:149390351-149390373 CCTCCTACATGCTGTAGCTGTGA No data
Right 940044020 2:149390378-149390400 AAATGCTCACTGGTTCTTACTGG No data
940044014_940044020 18 Left 940044014 2:149390337-149390359 CCCTCAGGGGAGACCCTCCTACA No data
Right 940044020 2:149390378-149390400 AAATGCTCACTGGTTCTTACTGG No data
940044012_940044020 25 Left 940044012 2:149390330-149390352 CCCTTGTCCCTCAGGGGAGACCC No data
Right 940044020 2:149390378-149390400 AAATGCTCACTGGTTCTTACTGG No data
940044016_940044020 5 Left 940044016 2:149390350-149390372 CCCTCCTACATGCTGTAGCTGTG No data
Right 940044020 2:149390378-149390400 AAATGCTCACTGGTTCTTACTGG No data
940044013_940044020 24 Left 940044013 2:149390331-149390353 CCTTGTCCCTCAGGGGAGACCCT No data
Right 940044020 2:149390378-149390400 AAATGCTCACTGGTTCTTACTGG No data
940044018_940044020 1 Left 940044018 2:149390354-149390376 CCTACATGCTGTAGCTGTGAAGC No data
Right 940044020 2:149390378-149390400 AAATGCTCACTGGTTCTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940044020 Original CRISPR AAATGCTCACTGGTTCTTAC TGG Intronic
No off target data available for this crispr