ID: 940049887

View in Genome Browser
Species Human (GRCh38)
Location 2:149451183-149451205
Sequence CACCTTGCTGCTGCATCCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940049885_940049887 21 Left 940049885 2:149451139-149451161 CCGGCAGGTTCTAGAAGGGCATA No data
Right 940049887 2:149451183-149451205 CACCTTGCTGCTGCATCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940049887 Original CRISPR CACCTTGCTGCTGCATCCTC TGG Intronic
No off target data available for this crispr