ID: 940054189

View in Genome Browser
Species Human (GRCh38)
Location 2:149496367-149496389
Sequence TCATACTGAATGGGTAAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940054189_940054194 -10 Left 940054189 2:149496367-149496389 CCAGTTTTACCCATTCAGTATGA No data
Right 940054194 2:149496380-149496402 TTCAGTATGATATTGGCTATGGG 0: 396
1: 10256
2: 5460
3: 4340
4: 3918

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940054189 Original CRISPR TCATACTGAATGGGTAAAAC TGG (reversed) Intergenic
No off target data available for this crispr