ID: 940057413

View in Genome Browser
Species Human (GRCh38)
Location 2:149527205-149527227
Sequence ATGTCCAGTTACTATGTGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940057413_940057414 9 Left 940057413 2:149527205-149527227 CCTGTCACATAGTAACTGGACAT No data
Right 940057414 2:149527237-149527259 TTATCTCGTTGACAGAGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940057413 Original CRISPR ATGTCCAGTTACTATGTGAC AGG (reversed) Intergenic
No off target data available for this crispr