ID: 940057563

View in Genome Browser
Species Human (GRCh38)
Location 2:149528956-149528978
Sequence AACCCACTAGGGGCTCAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940057563_940057571 27 Left 940057563 2:149528956-149528978 CCTGTCTGAGCCCCTAGTGGGTT No data
Right 940057571 2:149529006-149529028 AGCATGAGAGTTGTGTTCTTTGG No data
940057563_940057567 -2 Left 940057563 2:149528956-149528978 CCTGTCTGAGCCCCTAGTGGGTT No data
Right 940057567 2:149528977-149528999 TTAATTAGACCATTGTCATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940057563 Original CRISPR AACCCACTAGGGGCTCAGAC AGG (reversed) Intergenic
No off target data available for this crispr