ID: 940057567

View in Genome Browser
Species Human (GRCh38)
Location 2:149528977-149528999
Sequence TTAATTAGACCATTGTCATC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940057563_940057567 -2 Left 940057563 2:149528956-149528978 CCTGTCTGAGCCCCTAGTGGGTT No data
Right 940057567 2:149528977-149528999 TTAATTAGACCATTGTCATCAGG No data
940057560_940057567 23 Left 940057560 2:149528931-149528953 CCAGGTAAATTCACACTGACTCA No data
Right 940057567 2:149528977-149528999 TTAATTAGACCATTGTCATCAGG No data
940057559_940057567 24 Left 940057559 2:149528930-149528952 CCCAGGTAAATTCACACTGACTC No data
Right 940057567 2:149528977-149528999 TTAATTAGACCATTGTCATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940057567 Original CRISPR TTAATTAGACCATTGTCATC AGG Intergenic
No off target data available for this crispr